SimpleSearch - Line and FST details


Line specific information

 
Line ID 440H11
Vector Used pAC161
Line Availability only available from NASC (N442239)
Segregation Analysis 50:47:46
Confirmed for Hit At4g14540
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g14540

 
Sequence (A. th genome BLAST matches underlined)
>88-K018208-022-440-H11-8409
TATCCTGAAATTTCCCGGACTGAAGCCTTTACATTGAATATATCCGGATTATTATCCTGA
TGGCTCGACCTTATGGCTGCACGATCTCAAGAGGAGGACTCGGACTACGATTCTGGAGGA
CACAAAGACGGTGGAAATGCTTCCACACGAGAGCCAGATAGGTTTCTACCGATCGCTAAC
GTTAGCAGGATCATGAAGAAAGCACTTCCTGCGAACGCAAAAATCTCTTAGGATGCTAAA
GAAACGGTTCAAGAGTGTGAATCGGAATTCATAACTTTCATCACCGGTGAGGCTTCTGAC
AAGTGTCAGAGAGAGAAGAGGAAGACTATCAACGGTGACGATCTTCTTTGGGCGATTACT
ACTCTATGGGATCCTCCCTTATAGTGAGATCTTTAGCGGGAAAATCACGGGTTTATGTTT
TTTGATGGAAAAATTACGAGTTCACGTCTTCTCAATTATATCTCTGTATATTTGAGAAAT
TTGGAAAAATATTAATTTTATTACATCGGGATTAGATGTGCTGGTTAAACTTAAATTGGT
ATTGGCTTAAAGATTTTTAGCTGGATTAATTCAATTTTACAAAACTTGATGGGATAATTG
GGGTAAACCCATTGAAACCATTAAACATTTACAACTCAACCTCATTTTTACTCAACAAAC
CAATTTGATCCAAT
GenBank Accession BX290891 [GenBank]
Graphic View Graphic view of gene At4g14540
Predicted Position of Insertion Chr4:8344630 - go to primer design
BLAST e Value 2e-123
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g14540 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation nuclear factor Y, subunit B3
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40