SimpleSearch - Line and FST details


Line specific information

 
Line ID 441C09
Vector Used pAC161
Line Availability only available from NASC (N442273)
Segregation Analysis 50:9:6
Confirmed for Hit At1g49160
Parent of DUPLO pair none
Parent of pair(s) 3537, 7155, 9750, 92931

Gene hit At1g49160

 
Sequence (A. th genome BLAST matches underlined)
>67-K018217-022-441-C09-8409
GATCCTGTAGATTTCCCGGACATGAAGCCAGTTCCGCGAATAGGTCGACCTGCAGCCAAG
CTATGGGATCCTCCCTATAGTGAGACTATGTAGATATTTCAATCCCGTTAAAATCTGTCT
CGCCCAACACTTGACAGCCTTCATATTCACCTTTCTATGTTTCTTACGGTACCTTCAAGA
AAACCAAGATTTCGCTGCTTTAAACACAACTCCAAAACCGCTATTTTCGCGGCGACATAA
CAAGATAGTATAAAAATGAGCAAAATACATACTGCCGGAGACTTCCTGAAGTGAACAACT
CGGTAATTATGTTAACCGTCTTGTTCTTGTCATCGATCCACGAGTTATAAAACCTTATGA
TGTTTTTATGCTTCAGAGATTTCAAAAGCCGCACTTCGGAATATAGCCTCTCTATGGGAT
CCTCCTTATAGTGAGANNANNNNNGAAGAGTNNTTACCANTTTTTTTTTCATTCAAAAAT
GTAGATATCNGCACCGCTCTTATAAAA
GenBank Accession BX291934 [GenBank]
Graphic View Graphic view of gene At1g49160
Predicted Position of Insertion Chr1:18181055 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F27J15
Hit Gene Code At1g49160 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX291934 [GenBank]


Last Updated on 31.08.2016 09:40