SimpleSearch - Line and FST details


Line specific information

 
Line ID 443F03
Vector Used pAC161
Line Availability only available from NASC (N442495)
Segregation Analysis 50:23:17
Confirmed for Hit At1g20330
Parent of DUPLO pair 211
Parent of pair(s) none

Gene hit At1g20330

 
Sequence (A. th genome BLAST matches underlined)
>22-K024538-022-443-F03-8409
ACAGTTCCTTTAGGAGCAACTCCAACCGCTGACAAAATCTGAACCACAATGTGATTCCTC
CAATAAGCAAGCCTACCCATCTTAAGCCTATGGGATCCTCCCTATAGTGAGTCGTATTAC
TCATCGCTTTAGTGGGATTTGGTAACCCAATGTGTTATTCTCTCTTGGGTATCTTCGGTT
TCTCCCTCTTCTGGGGAAACGGGGTGTGGGGGTCTTTCTGTTGTTGTGTCTTTTCCTGGT
CTTCGTCCTTTTCCTTATATTTCTCCGGCGCAGCCTAGTCATATAATTTATTTTTTTATT
CTTGTTATTTCCTCTTGTATACCTCTTATTATTATTGTTGCAATCTGCTTACTGGAAGAT
ACCTGTTTCATCTTCAGATTGGTCTGAGTTTGATGCGCAAATATACACTCGTATTCTTCG
ATACTGGCGGTTGTGGCTAACTATTCTGTGT
GenBank Accession BX943135 [GenBank]
Graphic View Graphic view of gene At1g20330
Predicted Position of Insertion Chr1:7039092 - go to primer design
BLAST e Value 9e-44
Hit Clone Code (BAC ID) F14O10
Hit Gene Code At1g20330 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation sterol methyltransferase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40