SimpleSearch - Line and FST details


Line specific information

 
Line ID 446A02
Vector Used pAC161
Line Availability only available from NASC (N442722)
Segregation Analysis 50:37:30
Confirmed for Hit At3g17730
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g17730

 
Sequence (A. th genome BLAST matches underlined)
>09-K023729-022-446-A02-8409
AATTGACTTGGGTACGTACCTATGACTTCACCTCATTTATCTTCTCTTACTCGAACTTAT
ATATATATATATATATATATATATATACTCCTCTCTCGTGAGCGCATAAATAAATAACAT
ATGGGCTCTCTGGGGGACCCCCCCTAGAGAGAGCGCCTGAACCCGAGCCCTCCCGCACTC
TGTGTCCCTTGGGGGGGGGGGG
GenBank Accession BX891085 [GenBank]
Graphic View Graphic view of gene At3g17730
Predicted Position of Insertion Chr3:6064347 - go to primer design
BLAST e Value 7e-17
Hit Clone Code (BAC ID) MIG5
Hit Gene Code At3g17730 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAC domain containing protein 57
Insertion Classification 5' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03