SimpleSearch - Line and FST details


Line specific information

 
Line ID 450H07
Vector Used pAC161
Line Availability available as T3 set from NASC (N443195)
Segregation Analysis 50:38:31
Confirmed for Hit MPO12
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit MPO12

 
Sequence (A. th genome BLAST matches underlined) 
>56-K019118-022-450-H07-8409
TGAGCAGAGTATTTTTAGAAGATCTCGTTGCCTTAAAGAGATGGTCCATTCTATCCTATG
GGATCCTCCCTATAGTCGAGAATCAATCAAGGCCATCAATTTACGATCACCCAATGTAGA
GATCCATATATGGTATTTTATCTGATATTTTCTTACTCACTATGGGATCCTCCCTATAGT
GAG
GenBank Accession BX292071 [GenBank]
Graphic View Graphic view of sequence BX292071 of line 450H07
Predicted Position of Insertion Chr5:16149639 - go to primer design
BLAST e Value 4e-35
Hit Clone Code (BAC ID) MPO12
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX292071 [GenBank]


Last Updated on 10.06.2021 13:37