SimpleSearch - Line and FST details


Line specific information

 
Line ID 450H07
Vector Used pAC161
Line Availability only available from NASC (N443195)
Segregation Analysis 50:38:31
Confirmed for Hit MPO12
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit MPO12

 
Sequence (A. th genome BLAST matches underlined)
>56-K019252-022-450-H07-8409
TGATCATGAGATTTCCNGGACATGAAGCCATTTTCTTTTTCTCTGGTGTTCGTACAGCTC
TTACCTCAATCATATGCTTGGGCACTCAACCGGTGATTATGAAATCTGATTGTCAAATAT
CAATCAAGGCCATCAATTTACGATCACCCAATGTAGAGATCCATATATGGTATTTTATCT
GATATTTTCTTACTTGCTATGGGATCTCCCNTTATAGTGAG
GenBank Accession BX292072 [GenBank]
Graphic View Graphic view of sequence BX292072 of line 450H07
Predicted Position of Insertion Chr5:16149616 - go to primer design
BLAST e Value 3e-85
Hit Clone Code (BAC ID) MPO12
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03