SimpleSearch - Line and FST details


Line specific information

 
Line ID 451B06
Vector Used pAC161
Line Availability only available from NASC (N443218)
Segregation Analysis 50:48:37
Confirmed for Hit At4g01100
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g01100

 
Sequence (A. th genome BLAST matches underlined)
>42-K018834-022-451-B06-8409
TTGACTCCATGGGAATTGGGGATCCTCTATGGGATCCTCCCTATAGTAAGACACAAACTG
CTGTTGCACCTCTGGAAAGGATGAACATGTTACTTCAGGTTTTTTCCTTTGATGATAGCT
CTTGGTAAGGAACATATAAATGACTGGACAGTTAACCTGTTCGTTGTCAATCTACTATGG
GATCCTCCCTATAGTGAGAGAATTAGTACGAGCCGTGTACCTTTCCTTTCACGTCAAAAC
AAATGAATCATCTTCTTCGTCCTGAAAACTCATGACCTGTCCTGATATTACCCNTATGAT
AAAAGCCTCTATTGCCCTTTGCTCTCCTGAGACTGAATCGTTGATACCTCTGGAGAACAC
AAGCGTGTCGTGCTCCACCATGTTGACTAATATTTTCTTCTTGTCATTGAGTCGTACCAC
ACTCTGTATGAACTGTTCGCCAATCTTTACGGCGAGTTCTGTTACGTCCTCTATTTGAAT
CTTTGACTCCATGGGAATTGGGGATCCTCTA
GenBank Accession BX292093 [GenBank]
Graphic View Graphic view of gene At4g01100
Predicted Position of Insertion Chr4:477933 - go to primer design
BLAST e Value 6e-46
Hit Clone Code (BAC ID) F2N1
Hit Gene Code At4g01100 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation adenine nucleotide transporter 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03