SimpleSearch - Line and FST details


Line specific information

 
Line ID 451G10
Vector Used pAC161
Line Availability only available from NASC (N443282)
Segregation Analysis 50:42:37
Confirmed for Hit At5g06710
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g01010

 
Sequence (A. th genome BLAST matches underlined)
>79-K018834-022-451-G10-8409
TATGGGATGCCTCCCTATACTCATGACTTAAATGGTGTGATTATATACGTACACGCTATG
GGATCCTCCCTATACTGAGAGCCTCTAGCGACAGAGACTGAAGACGATGCCGACTCTCTG
TGACCAACAAACGCCACATTTACCGCCTCGCAGAACCCAACACCCTTCTCGTACGCAAAT
GCCAACAAGGCAGAGGGAGTATTGATCTTCGGGGTCCTCTCCACGATGGATAACTGCTCC
TTTTCACTGCCAACGAGAAGCCCCTCCCTAAGGTGTAAACCATACTCAACAATTCCTTCA
AATTAAGTACGAAACACAGGCCCCGGAACTCATCATCGAGCGTAACATCGCCCGTGAATT
AACTGAGAAGGATAGGTGGTAGGTAGTTCGATGCCCGAGCATGGAGCCTAC
GenBank Accession BX292165 [GenBank]
Graphic View Graphic view of gene At2g01010
Predicted Position of Insertion Chr2:3718 - go to primer design
BLAST e Value 2e-67
Hit Clone Code (BAC ID) F23H14
Hit Gene Code At2g01010 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation rRNA
Insertion Classification TS2TE
Confirmation Status unknown

Gene hit At5g06710

 
Sequence (A. th genome BLAST matches underlined)
>79-K018836-022-451-G10-8409
TGATCTGANATTTCCCGGACATGAAGCCATTTACTGCATGCATGTCGAGCCTATGGGATG
CTCGCGATGCTGAGAGTGTCATGGGGGATCTACAGAGGACTAAACCCGTTGTTCGTCATA
TGTTTTGGCTCTGGGCGCCGGTTTCTTCTTCGCATCCTCTACCGACGGATACTATGAGGA
TGACAACGATCTGTGAGCACCTTAAGCAACATCTATGGCCATGCAGAACCCAAGATCCTT
CTCGGAGAGTATATGTCCACGATACAGAGGGATTATTAATCTTCGAGTTCTTCTCCATAA
AACACAACTGTTGCTTACTATTGTCGCCTATGGGATCTGNCTTATAGTGAGAGACTTGGC
TTCGCCTCCTCAGAAATTGAAACCTATAAGGTGTGGCGTTAAGCTTCCGTCGTCGTCGGA
GGATCGACATCCTCTTGATATTCTCGCCGGAACCCTATGGGATCTCCCCTAATAGTGAGA
ANCNNANAANANTATGGGATCCTCCCTATAGTGA
GenBank Accession BX292166 [GenBank]
Graphic View Graphic view of gene At5g06710
Predicted Position of Insertion Chr5:2069995 - go to primer design
BLAST e Value 4e-72
Hit Clone Code (BAC ID) MPH15
Hit Gene Code At5g06710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation homeobox leucine zipper protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03