SimpleSearch - Line and FST details


Line specific information

 
Line ID 452G01
Vector Used pAC161
Line Availability only available from NASC (N443369)
Segregation Analysis 100:84:34
Confirmed for Hit At3g55610
Parent of DUPLO pair none
Parent of pair(s) 11994

Gene hit At3g55610

 
Sequence (A. th genome BLAST matches underlined)
>07-K018811-022-452-G01-8409
GGACATGAGCCATTTACATTAGTAATATATACAGGAGTGACCACACTTATCAGAACATGC
ATGGAATACAGAGCGGTAGGTCCTTTGAAAAATTTGAAATCAGCAGTAATTTTACCTTCC
ATGTTGGTGAATATGATCTATAGCACCATATACGTCTTCTACAATTTCAACGGTGCAGGC
CTTGGAACTGTACTCGTGGTGAAATGATTTTGTTTCCGGAATATTCAGTTTTGCACTTGC
TCTTGGCCCACCATACAAAGTGACGCCTGCAATTTGACACGTACACTTCAGACAAGTCTC
TTTGAAAACGGTCAACAAACAAAACACTATCTTAATTTCAGTGTTTATGGTTTGAAATAC
TCTATGGGATCTCCCCTTATTGGTGAGAGNGATTTGTTCTTATGTATAGGTGGGAATAAG
CACAAGCAGGATTCATGCCCGTGGTCCAGTTGGGAGTTGAAGGATTATTGACAACAAGAT
GGTACTACAATTGAGTTATTTTGTTTCTCTCTCTTCCATAGTTCACTGATTTGTCAAAAG
CTGTGAAGTTTANATGGTTGTGGGTGATGAATGACACGATAATGAGAGGAAAGGGACAAG
TTGTGGATGGAAAACATGGAATCGTTTACACCCATAAGGATCTTCCTGTCTTACAAAGGA
CAGAGCTTGTTGAGAATTGGAATTAGTTCTCTCTTTCTCTGCTGATGGCATATTATGTTT
TACAAATTATGATTGAAGTTTTTTCCCCCCTTTAACATAGGATATAGTGGTTCCTTGGAG
GTTGTACCATCATAAGAAAATCTCCTTACTTAAACGGGCCTTGAAAATAAGGGAAAGTT
GenBank Accession BX292247 [GenBank]
Graphic View Graphic view of gene At3g55610
Predicted Position of Insertion Chr3:20624927 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F1I16
Hit Gene Code At3g55610 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation delta 1-pyrroline-5-carboxylate synthase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX292247 [GenBank]


Last Updated on 31.08.2016 09:40