SimpleSearch - Line and FST details


Line specific information

 
Line ID 453B02
Vector Used pAC161
Line Availability only available from NASC (N443406)
Segregation Analysis 49:48:35
Confirmed for Hit MIJ24
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At1g17460 can not be ordered because the confirmation of this insertion failed.

Gene hit At1g17460

 
Sequence (A. th genome BLAST matches underlined)
>10-K018812-022-453-B02-8409
TAATGATAGCAAACTGATTGGCGGAGATCAAGATGCGATTGATGCTTTTAGCAAGGGTAC
ATAATATGAACAAACAGCTACTGAAAGCATAGATGCACCAGCTATGGGAATCCTCCCTAT
AATGAGAGTTTCTTAAAATAATTTTTGTCAATATAGATGTTATTTTCCTATAAAAATCCA
TGCATGACGTTAACAAAGGCTATGGGATCCTCCCTATAATGAG
GenBank Accession BX292290 [GenBank]
Graphic View Graphic view of gene At1g17460
Predicted Position of Insertion Chr1:6000839 - go to primer design
BLAST e Value 4e-35
Hit Clone Code (BAC ID) F1L3
Hit Gene Code At1g17460 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation TRF-like 3
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 406G11

Gene hit MIJ24

 
Sequence (A. th genome BLAST matches underlined)
>10-K018814-022-453-B02-8409
TATCATGAAATTTCCCGGACATGAAGCCATTTACAATTGGGGATCTCAAGAAGATCCTTT
GATCTTTTACTACGGGGTATGACATTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGG
TCATGAGATTATCAAAAAGGATCTTCACCTATGGGATCCTCCCTATAGTGAGATTAGGAT
ATAATAAAGTCAGATGTTTTAAAAAGAAGAGTTTTCTATGAATTCCTGTTTCTTAAAATA
ATTTTTGTCAATATAGATGTTATTTTCCTATAAAAATCCATGCATGACGTTAACAAAGAC
TATGGGATCCTCCCTATAATGAG
GenBank Accession BX292291 [GenBank]
Graphic View Graphic view of sequence BX292291 of line 453B02
Predicted Position of Insertion Chr5:15850190 - go to primer design
BLAST e Value 8e-67
Hit Clone Code (BAC ID) MIJ24
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40