SimpleSearch - Line and FST details


Line specific information

 
Line ID 453H07
Vector Used pAC161
Line Availability only available from NASC (N443483)
Segregation Analysis 50:49:43
Confirmed for Hit At1g13820 At2g20110
Parent of DUPLO pair 2324, 11960
Parent of pair(s) none

Gene hit At1g13820

 
Sequence (A. th genome BLAST matches underlined)
>56-K018812-022-453-H07-8409
ATGAGCATTTACATTAGATATACATGCATGCATGTCGACTCTATGGGATCCGTCCTAGAA
TGAGACTGATCCGAGCCTCGGTGCTGCTGTCGCAATTGACATTGCGGTCAACCATCCAGA
AGCGGTACTTATAGAATTCTTGAGGAGCTTTCATTATTTCTCATAAAGAAGTTTTTAGTC
AACATGTCAGAAGATATTGGCTATGGGATCCTCCCTATAATGAGAGNCNNGCTCCACCAT
GTTGACGAAGATTTTCTTCTTGTCATTGAGTCGTAGGAGACTCTGTATGAACTGTTCGCC
AGTCTTTACGGCGAGTTCTGGTAGGTCCTCTATTTTATTCTTTGACTCCATGGGAATTGG
GGATCCTCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX292391 [GenBank]
Graphic View Graphic view of gene At1g13820
Predicted Position of Insertion Chr1:4736553 - go to primer design
BLAST e Value 2e-67
Hit Clone Code (BAC ID) F16A14
Hit Gene Code At1g13820 [TAIR] [MIPS] [SIGnAL]
Gene Annotation alpha/beta-Hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g20110

 
Sequence (A. th genome BLAST matches underlined)
>56-K018814-022-453-H07-8409
TGATCTGAGATTTCCCGGACTGAAGCCTTTACATTGAATAGTACTGCATGCATGTCGACC
CTATGGGATCCTCCCTATAGTGAGAGTGCTCCGAGCCTCGGTGCTGCTGTTGCATTGACG
TTGCGGTCAAGCATCCACAAGCGGTACTTATAGAATTCTTGAGGAGCTTTCATTATTTCT
CATAAAGAAGTTTTTAGTCGCCATGTCTGAAGATATTGACTATGGGACCCTCCCTAGTCT
CAGATGGCAAACATAATTAAACCAATGGATGTGAAAGCACTATGTTCTGTTCTGGTTGCT
GTAGCTGGGGAAGCTGCAAAGACATTAACAGAAAAACGGTTAGCAAATCAGAAAGAATCT
TTCGTAGCTTCTTCTGCGCAAGATCAAGGACACGTCAATAATAAAGCTGAGAAATCTGGT
TTAGAGGATTCAAATGCAGATGGCTCCAAAGGGAGGTCACTATCTCCAGAAACTTTGGCA
TTGATGTGTGACGAACGGGACACAATGTTAATGGTTGCAGCTTCACCTAATTGTTCGGTG
GAGCCTACGTCACAGCTACCAAACGGGCAAGACCAGGTTTATGCAGAACAAGAAAAAGTA
GTATTAACCAAGTTCCGTGACTGCCTTTAACGAATAATCTCCTGTGGAGAAGTAAAAGGT
ACCCATTTCTTATATCATCAAGAAAATGGAGTATATGCCCAAACATAAAGATTCACTTAT
TCAAACCTA
GenBank Accession BX292392 [GenBank]
Graphic View Graphic view of gene At2g20110
Predicted Position of Insertion Chr2:8685888 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T2G17
Hit Gene Code At2g20110 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tesmin/TSO1-like CXC domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23