SimpleSearch - Line and FST details


Line specific information

 
Line ID 454C04
Vector Used pAC161
Line Availability only available from NASC (N443516)
Segregation Analysis 60:59:56
Confirmed for Hit At4g34850
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g34850

 
Sequence (A. th genome BLAST matches underlined)
>27-K018837-022-454-C04-8409
TGATCTGANATTTCCCGGACATGAAGCATTTACATTGAATATATTCAAATGAGTGGAGCT
GGAAAAACCACTCTTCTCGACGTCCTATGGGATCCTCCCTATAGTGAGACTCCCTTGATT
TCAAAGCGGGTGAGTTCTTCTCACACTCGGTGATGTCTGATAACAATCAATATCATGGAT
TGTGCGTCGGCTATCTTTTCACCACATGCCTATGTGATCCTCCGCTATAATCTTTGGACT
ATTGATGGACATTCTCATTCATGAACTATGGGATCCTCGCTATCTGAATCTTGCTTTTGG
ACCTGGTGTTACATTTGAAGGCATTATCGCTCGAAACCTTGATGTCTGAACAATAAGTTT
TTACCTTGCAGATCGAGAAAGAACCCCTTATGCTTTAATAAAGACATGAAGCTAAACATA
CGAAATATTTTTTACGATGCTTAAATCTTTCATAGTCTAAAAATATTTCACAAAGCAAGC
AACGTAAAATTTGCAATTGAAAAATGAAGAAAAGAGTCGTTATCAGCATTAAAGCCAGGA
ATCACGAAGAAGGTTCTTCTTAGCTCATCTCTTTCCAACGTTTTCAACAAGTCCAGGAGT
TGGATCTTCTCATAACGGGTTTCATCTGTTTGTCTTCCTCAAGACAAACCATACCAACAT
GTGACGGATCTTCCAGCATCATCTTGGCTACTAAGTATCCTGCGACTGACCAAGTCTGTT
TTTTACGCGACTGTTTCCCCACGTATCTCCCTACCTTCCATCATAGTATTCAGGCCAGTG
GTCCTTATGAAGCCTATGGGACCCCCCCC
GenBank Accession BX292440 [GenBank]
Graphic View Graphic view of gene At4g34850
Predicted Position of Insertion Chr4:16609430 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F11I11
Hit Gene Code At4g34850 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Chalcone and stilbene synthase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit HG968980 [GenBank]

Gene hit At3g25600

 
Sequence (A. th genome BLAST matches underlined)
>27-K018835-022-454-C04-8409
ATTCCTCCGATAGATTCCGCAACTCGAACTTTCCATTATATTAAAGCCTTTGTAACATAA
GACAAGCTATGGGATCCTCCCTATAGTGAGATCCGAAGCGCGGTGTCTTCGAATTTAATA
AACTATTCCTCTCCGATCTTCCCTATAAAAGACCTAAAACAAAAAAAATCTCTTTCCTTC
TTCTTTCTCCATCAATGGCGTCAACAAAACCAACCGATCAAATCAAACAACTCAAAGATA
TCTTCGCTCGTTTCGACATGGACAAGGACGGAAGCTTAACGCAGCTATGGGATCCCCCCT
ATAG
GenBank Accession BX292439 [GenBank]
Graphic View Graphic view of gene At3g25600
Predicted Position of Insertion Chr3:9307146 - go to primer design
BLAST e Value 7e-61
Hit Clone Code (BAC ID) T5M7
Hit Gene Code At3g25600 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Calcium-binding EF-hand family protein
Insertion Classification Promoter
Confirmation Status unknown


Last Updated on 14.10.2014 10:23