SimpleSearch - Line and FST details


Line specific information

 
Line ID 454C10
Vector Used pAC161
Line Availability only available from NASC (N443522)
Segregation Analysis 50:33:26
Confirmed for Hit At3g20810
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g20810

 
Sequence (A. th genome BLAST matches underlined)
>75-K018835-022-454-C10-8409
ATTGCCCGTGACTCTTTCTTTTTTCTCCTATTATACGACGGACTCAATGCTGCTGCTGGA
TAACCGGACCGGTCACGCGGAGGAGACTGACATCATTTCTTCACTTAGTTCTTAGTTAGC
TTGTGAGTGTTGATTAGTAGTCATTAGACGATGGTTTTAGCTTTAGTTGGCTCCTACGCT
GCTCTAAGTTGCCATGTCCATATTTTTTTAGGGTTCTTCTTAAGAATGTTGAATCTCATA
GAGTCGTGTCAACTGTATGATAAAAGGGTTTAGGGTCTATGGGATCCTCCCCTATAGTGA
GANNNTCNATACTGCCTATAGGGAGTTGTATCTCACCACAACCCTTTTCCAGTATGTTCT
CTTCAGAGAGACAGATAGCTGGGCAATGTAATACGAGGAGGGATGCGGATATTACCTTTC
GTTGACAAGTATCAATTGCCCTTTGGGAGACAGAGACCGTATCTTTGCTATTTTTGGAGA
CGACAAGCGTGTCACGCTCCCACATGTTGAACAAAGATATTCTTCTTGACATGGATTCGT
AAGAGACTCTGTATGAACTGTTCCCCAATCTTTACGGGGAGTTCCTGTTAGGGCCTCTAT
TTGGATCTTTGACTCCATGGGAAATTGGGGATCCTCTA
GenBank Accession BX292449 [GenBank]
Graphic View Graphic view of gene At3g20810
Predicted Position of Insertion Chr3:7276632 - go to primer design
BLAST e Value 3e-97
Hit Clone Code (BAC ID) MOE17
Hit Gene Code At3g20810 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX292450 [GenBank]


Last Updated on 31.08.2016 09:40