SimpleSearch - Line and FST details


Line specific information

 
Line ID 455G12
Vector Used pAC161
Line Availability only available from NASC (N443668)
Segregation Analysis 50:44:34
Confirmed for Hit At2g17560
Parent of DUPLO pair none
Parent of pair(s) 3385, 8263

Gene hit At2g17560

 
Sequence (A. th genome BLAST matches underlined)
>95-K018778-022-455-G12-8409
ATTGACTCAAGTGCTTTCTTCGTCTTCCTGTAATTTCACGAATCTTCCTCCGATTTTCAA
ATTTTCGAATTGATTTTTCGATTCTAATCAAATTTTAAACTGATTGTTGTTGGATCTTAG
TGAGGATTTCCGAAAAGAGTTTAACCTATGGGATCTCCCCTATAATG
GenBank Accession BX292656 [GenBank]
Graphic View Graphic view of gene At2g17560
Predicted Position of Insertion Chr2:7643271 - go to primer design
BLAST e Value 6e-74
Hit Clone Code (BAC ID) MJB20
Hit Gene Code At2g17560 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation high mobility group B4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40