SimpleSearch - Line and FST details


Line specific information

 
Line ID 460A08
Vector Used pAC161
Line Availability only available from NASC (N444072)
Segregation Analysis 102:81:64
Confirmed for Hit At3g61560
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g61560

 
Sequence (A. th genome BLAST matches underlined)
>57-K018855-022-460-A08-8409
TGATCTGTNATTTCCCGGACTGAAGCCATTTACATTGAATATATCCTGGAAATACGTTAC
CCGACGAGCCTTTAGATTCGTGACCCGAACCACAGAAATACGTTAACGACGTTAGTCTTT
TTTAAAGAAGGAATAAACGGACGTCAACGTTTAGTGCCTGGAACGTGGAGGCAACCAAGG
ATCCAACAAAGGCCTAGTCAGACTACAAAATCTTCTCTTTTTATGTCCTATACTTGGACA
AATAAGGCTAGTATAAAACAGACTGAGATGCTTCTTCAAAACAAAGAAGTCACATCTATA
ATGGGACTAACCATAAGGGAGTTGGTAGTATCCCCATTGGGGGGAAGCAGTACAATGGCA
ATCGCAAGGTTTGACCTCTTTGTAGCTATGGGATCTCCNNAATTAGTGAGACTGACACGA
NGCCTGACTATACGCATTTGTCTTACTGCTGAATAATATATGTATGGGATGATCGGTTAA
TTGTGGAGGGACAATAAACTCTCAGCTTCTGTTCTTGGTGTAGCGACTGCGATATGGGTT
CTGTTTGAATTGGTTGAGTATCATTTCTTGAGTCTTGTGTGTCACATTTTGATATTCGCT
CTCGCAGCCCTGGTTTTATTGTCCAATGCTCATGCCTTTATGAACAAGTAACCTTTTTTG
TTTGCATGTTTCCAGTTACAATCTACACGTTTCTCTTTCTTTGCTTTGCTTAAGGCTCCC
AAAAAACTTTAATTTTAGGAATCCACCTAAATTCCTGGAATCCTTATTAAAGAGGGAAAA
TTCCCTTATGATTGGTTCCGCACTTAAAAACGAGCTTGACCCGGGCCTTTGTTATTTTAA
GGGACATGGCTTTAGGAAGGGACTTGAAGAAATTT
GenBank Accession BX291147 [GenBank]
Graphic View Graphic view of gene At3g61560
Predicted Position of Insertion Chr3:22777858 - go to primer design
BLAST e Value 3e-146
Hit Clone Code (BAC ID) F2A19
Hit Gene Code At3g61560 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Reticulon family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX291148 [GenBank]


Last Updated on 14.10.2014 10:23