SimpleSearch - Line and FST details


Line specific information

 
Line ID 460F06
Vector Used pAC161
Line Availability only available from NASC (N444130)
Segregation Analysis 50:34:25
Confirmed for Hit At2g04038
Parent of DUPLO pair none
Parent of pair(s) 6888

Gene hit At2g04038

 
Sequence (A. th genome BLAST matches underlined)
>46-K018861-022-460-F06-8409
ATTTCCCTTGACCTCCTTGCGATTCTCTGTTCGAAACATCCTTCTCTGTTTCCTCTCGTC
GAGTACCATGATGCTTTGATGATGATCTTCGTCGGAAGTTGAGTTGTTGCTTATCATGAG
ATCTTGACTGTTGGATGATGAGGAATAGTTGTTGTTGTTGATGATCAAATCGTTTAGGTA
GTTTAAGGAAGAGGTTGGAGATGAAGGCATGTTTATTACGTTGTATTCCGGTGATAGATA
TTGGAAATATCCGTTGATTTCTGCCGGAATCATGGTTTTAGTTTGGTTTATATGAGTATG
TAAGAGTTTCTGTGTTTTTATTTTGTGTGAAGAATTGGGAAGTTAGTTTTGAAGTAAGAG
GAGGAAGTGGACCAAGGGTTTTATAATGGGGTTGTAGGAGAATCATGTAGAAGTGGGTCC
TATGGATTATAAGAGCATAGAATAAGAAGAAAAAATGCGATGCTATAATTCGTAATTTAT
AGTGGTGGAACATGGACAAAGAAATGGAAAGAGTTTAGTCATAACAAAAATATTGTTAGT
GTTTTATATATAACTTGTTCATTGGAAGTGAGAGCAGAAACTGCGAGAAGGTTTTTAAAA
TTTTGGTTTTTTTATATAATTTAAACCCAATAATAGTTAACTTGAGTTGTTTATTTTTGA
ACCT
GenBank Accession BX291223 [GenBank]
Graphic View Graphic view of gene At2g04038
Predicted Position of Insertion Chr2:1332188 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F3L12
Hit Gene Code At2g04038 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic leucine-zipper 48
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03