SimpleSearch - Line and FST details


Line specific information

 
Line ID 462G01
Vector Used pAC161
Line Availability only available from NASC (N444329)
Segregation Analysis 50:25:20
Confirmed for Hit At1g46480
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g46480

 
Sequence (A. th genome BLAST matches underlined)
>07-K018952-022-462-G01-8409
TGATCTGTAGTTTCCCGGACATGAAGCCTTTACATTGAATATTTCATTCTTCTTCCTCCG
GCGTCACTTCAGCCACTTTTGACCTTAAAAACTTCATTAGACCCGATCAAACCGGTCCGA
CAAAATTTGAACACAAACGAGACCCTCCTCATCAAGTCAGTTCCATTATTGTACTTCGTA
CATTTTACATCGTTTCTTTCGTTTGAAAAAAGAAGAAGAATTCACCCTATGGGATCCTCC
CCTATAGTGAGACTATGGGATCCTCCCTATAGTGAGATTATGTGAATTGCCAGATCCCGT
GTGGACGTGAATGGAGACACCCCGTGTGGACGTGAATGGAGACACCATGGGGATCCTCCT
GTTATGGAGGATATGGGATCCTCCCTATAACGAGACGATGGGAACCGCGCACTTCCGTGT
TATACTGAATGGGCAGCCTTCTTTTGGTTCTGAATGTAAAAAAATTGGGATTTTCTCTTT
CTAAGGG
GenBank Accession BX291372 [GenBank]
Graphic View Graphic view of gene At1g46480
Predicted Position of Insertion Chr1:17237819 - go to primer design
BLAST e Value 1e-96
Hit Clone Code (BAC ID) F2G19
Hit Gene Code At1g46480 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WUSCHEL related homeobox 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40