SimpleSearch - Line and FST details


Line specific information

 
Line ID 463C05
Vector Used pAC161
Line Availability only available from NASC (N444381)
Segregation Analysis 50:49:34
Confirmed for Hit At3g14030
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g14030

 
Sequence (A. th genome BLAST matches underlined)
>35-K018986-022-463-C05-8409
TGATATACTGACAGTTTGAGCTACCACTTCAGTGTAGCCCATTACCTTACATAATTCACT
CAAATGCTATAGCATCCTCCCTATAGTGAGAGNGNGGGANCCGGCCTCTTCTCTTCTTCT
GTGAATGTCCACATGCGCGTGCGGCCCTCGATGTAAATTCACCCTGCGGACGCCTGCGTC
CGCGCAGTCTTTCCCTGTTGGTAGAATCTTCTATTGACGGATGGATCTCTCGCTCTCATT
ATGCACAGCCAACTGCGACACTATAAATGGAAGGAGCGTTTCGCAATATGTCATGCTGCC
CCAGGATCTGGGCGTCTCGGATATTCTCCGATCTGAAGCCTCCATCTCGTCCAATGATGT
GAGCTGTCTGGTAACGGCAAGTCTCGGACTATTTACATCCGACTATGGGATCCTCCCTAT
AGTGAG
GenBank Accession BX291420 [GenBank]
Graphic View Graphic view of gene At3g14030
Predicted Position of Insertion Chr3:4646055 - go to primer design
BLAST e Value 2e-33
Hit Clone Code (BAC ID) MDC16
Hit Gene Code At3g14030 [TAIR] [MIPS] [SIGnAL]
Gene Annotation F-box associated ubiquitination effector family protein
Insertion Classification 3' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23