SimpleSearch - Line and FST details


Line specific information

 
Line ID 463E06
Vector Used pAC161
Line Availability only available from NASC (N444406)
Segregation Analysis 50:28:28
Confirmed for Hit At5g45840
Parent of DUPLO pair 2594
Parent of pair(s) none

Gene hit At5g45840

 
Sequence (A. th genome BLAST matches underlined)
>45-K018953-022-463-E06-8409
GGCACTCTCCTATGGGATCCTCCCTATATACATAACCGATGATTACGCAGCAAAGGTTCT
TACTTTCTTGCTTAACAAGAAAACTGTTTTAGTAGTTATTTCTTTCTTGCTTAACAAGAA
ACTGGTGTTCTTGATTCTTAATACAAGACCTATGGGATCCTCTCCTATAATGAGACCGGA
TCATCTTCTGCGCAATAACGAATCACATCAAGAAAGGGCTTATGGTTGACTCTTGACATT
GTATCAATCTGCAAATATAAGCTCTGAAAACATGAATCAAGTTTTGCGGTAAAAAGGGTC
TAAGAAAAACTGTTTATTTTAATTACCCTTCTGCGGTAAGTCATTTCCATAGCTCTTGTC
CATTCCCTATGGGATCCTCCCCTATAGTGATACTCCCCTATAGTGA
GenBank Accession BX291453 [GenBank]
Graphic View Graphic view of gene At5g45840
Predicted Position of Insertion Chr5:18594852 - go to primer design
BLAST e Value 2e-76
Hit Clone Code (BAC ID) K15I22
Hit Gene Code At5g45840 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX291453 [GenBank]

Gene hit At5g65180

 
Sequence (A. th genome BLAST matches underlined)
>45-K018986-022-463-E06-8409
GATCATGAAATTTCCNGGACATGAAGCCATTTACAATTGAATATATCCGGACATGTATGC
GAGATCCACGCTGACCGGCTCCAAATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCG
AGCGCTATAACGTGGGACAGCAACTTTATCCAGCCTGCCATACACAACTATATAATTGTT
GCACAGAGGAAGCTGATGGGACCCCACTGATAATCATGANCTATAGTGAGANCGAACAGA
AATGTAAAAAAATCGAGTGGGAAAATGAAAATTGAGATCGATAAAAAAAGAAATTGGAAA
AATAAAAAAATGAAGTAAGAAAAAGGAGAAATTAATGGCAGACGGCGTTAGGACAAAGAA
AAAGAGAACGCCTTTCTATGGGATCCTCCCCTATAGTGAGANTGGNNNNANNGNNANNAN
NNNTNNNNANANNGATAAAAAAAAAAAAAAAAAANAAGGNGGGGGGGGGGAAAAAAAAAA
GAAAAGGGAAGGTAAAAAGATAGATAGGAAGGTAGAGGGAAGGGGGATAGATGGATAGGT
GAAGGAGGGATATGAAAAGGGCAGGAGAAGGGGTGGGGGGCGGAAAAGGGGGGGAGGTTG
GGGGGTTGGNAAGAGGGAAAGATAAGAATAAGAAATTA
GenBank Accession BX291454 [GenBank]
Graphic View Graphic view of gene At5g65180
Predicted Position of Insertion Chr5:26045378 - go to primer design
BLAST e Value 7e-18
Hit Clone Code (BAC ID) MQN23
Hit Gene Code At5g65180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ENTH/VHS family protein
Insertion Classification TS2TE (5')
Confirmation Status unknown


Last Updated on 31.08.2016 09:40