SimpleSearch - Line and FST details


Line specific information

 
Line ID 466B10
Vector Used pAC161
Line Availability only available from NASC (N444662)
Segregation Analysis 50:18:17
Confirmed for Hit At5g62940
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g09690

 
Sequence (A. th genome BLAST matches underlined)
>74-K019013-022-466-B10-8409
TGATCCTGAAATTTCCCGGACATGAAGCCTTTACATTGAATATATCCTGATAAAGTTCAC
CATAAATGCATAGATTTCGCCATTCCCATATACACATTTCATCTACACATCGGCCTTGAG
ATTTATGCCAAAATGATACACTCATCATACATAACTACTGAGAGGTTGATCTACGCAATA
TCACCTGCACCCCATATACCTAACATAATTCACTACAAATGATGATGGAATACCTCCCCT
CATAGTACTGACATGATTAACCATGACCAGGTTGTCATTGTTCACTCCCATGAGATCAAA
CTTACTGTCCAAGAAATCAATAGGTCTATGGGATCCTCCTTATAGTGAGANNATNNNGAT
NCGNTNTTGTACTTATTCTCTTTGAGTTATTTTATGTAGAAAGAAGTAATTTTAATATAT
ATTTGTCAACAAAAGAAGGGAGCTTGAAGTTCACGCTTGTAAAGGTGTCAGTTTTGCAGC
TCATTATCACAATGTTCTTCTCTCTCGCGCACTTGGGGTTTTCTTCTCATGGCCCAAAAG
AACCCACTTTAATGTATGTTCAGGGCTTCTTCTTCTTCGGCCTGTTGCTCTGAAAAATTG
GGCCCGAACTTGGGATTTAGGGATTTCGTTTTGATAATGGAGGAAATGGCAAAAAGGATG
GCCTAGTGGCAAGACGAGTTA
GenBank Accession BX291653 [GenBank]
Graphic View Graphic view of gene At3g09690
Predicted Position of Insertion Chr3:2972093 - go to primer design
BLAST e Value 5e-96
Hit Clone Code (BAC ID) F11F8
Hit Gene Code At3g09690 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation alpha/beta-Hydrolases superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status unknown

Gene hit At5g62940

 
Sequence (A. th genome BLAST matches underlined)
>74-K019008-022-466-B10-8409
TATCCTGACATTTCCCGGACATGAAGCCATTTACATTGAATATATCCTAATGGTGATGAT
CATATATTAGATACCATAATGCTTTGGCATGTCGATATATCCATGAGACCACCACCATTT
CCATTGCCTCCCGTAGAAATCCCATTAAATCCACCATTGTTGTGTGATGTTGTTAAGACC
TGACACCGTGATTCACACCCATGTGATGATCATGATGATGATGATGATCTCCGCTACTTC
CATGATTAACCATGACCACGTTGTCATTGTTCACTCCCATGAGATCAAACTTACTGTCCA
AGAAATCAATAGGCCTATGGGATC
GenBank Accession BX291652 [GenBank]
Graphic View Graphic view of gene At5g62940
Predicted Position of Insertion Chr5:25257424 - go to primer design
BLAST e Value 9e-73
Hit Clone Code (BAC ID) MQB2
Hit Gene Code At5g62940 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Dof-type zinc finger DNA-binding family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03