SimpleSearch - Line and FST details


Line specific information

 
Line ID 466F09
Vector Used pAC161
Line Availability only available from NASC (N444709)
Segregation Analysis 50:11:8
Confirmed for Hit At2g45660
Parent of DUPLO pair none
Parent of pair(s) 4612, 4656, 4674, 4691, 78968

Gene hit At2g45660

 
Sequence (A. th genome BLAST matches underlined)
>70-K019008-022-466-F09-8409
TGATCTGAAATTTCCCGGACATGAAGCCTTTACATTGAACAGCTTAAGTTTCTCCACATT
ATAAGTATTGTTAGAATCATCTTCTGAAACCACTCATAATTATAACTCAATTTCTCATCT
CTTTTAGACTCAAGTGTTTAAGGAACAAATTGAGCAGCTCAAGCAAAAGGTACAGTAGGT
TTTATGAGTGTATGATAAACAGATATAAGTATGTATGCAGATTGTGTAATATTCCAAGTA
TAGTAAGCCTCTTGTGCTTGCTTCTTACAAATTGGAATCTAAAACTTTTGCAGGAGAAAG
CCCTATGGGATCCTCCCTTATAGTGAGANNGNNNTNTNNCCCGGAAAGANATTTCTTGTA
CATATGTACCCTACTACGAGATCTGTGATTTGATCCAGCGACGTTCAGATTATATACCTC
TTGGGGCGATATTGATTACCGCTCGTTGATGTTATCTACCAGAAGTATTACTTTTCGAGA
ATTGTCTCCTACGCAGAGAGATCGTCAAGAATAAACCTGCATATTTTCTTCAGAAACCCG
GTTTGGTGCTGACTCGATTCCTAGGATGGCTCAAAATAACGATCCATGGCATCTTGGATA
CTGGCAAAAACATATATAATTGGAACATTAAAGTAATCCTCAGAAATCCAATTTAAATCC
CCAGGGGGGTTCCAAAACCTTTCTTATTGAA
GenBank Accession BX291703 [GenBank]
Graphic View Graphic view of gene At2g45660
Predicted Position of Insertion Chr2:18808441 - go to primer design
BLAST e Value 4e-118
Hit Clone Code (BAC ID) F17K2
Hit Gene Code At2g45660 [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 20
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR810691 [GenBank]


Last Updated on 14.10.2014 10:23