SimpleSearch - Line and FST details


Line specific information

 
Line ID 467C08
Vector Used pAC161
Line Availability only available from NASC (N358734)
Segregation Analysis 58:2:1
Confirmed for Hit At5g20885
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g20885

 
Sequence (A. th genome BLAST matches underlined)
>59-K019009-022-467-C08-8409
TTTCCCGGACTGAAGCATTTACATTGAATATACCTAGTGGGATCCTCCCTATATGAGCTT
CTTCATCGAAGATTCTGGTCTCATAGTCACTCAGCTTCTCTACAAAATGGCTGTTCTCAT
CACCGTCTTGAGATGGATCCTCGCTTGGATCTTACGCTACCGATCCAGATCCAGATCCAC
CTCTTCTTCCACTTCCGCCTGTCCTTCGATTTCCTCACAGGCGATCAAAGAAAGCCTCTC
CGTGACGACGTTCCGTGACGCAGCTGAGAGATCTCCGGCGATGATCAACGACACCTGCGC
TGTGTGTCTCGGAGATCTGGAAGATGGAGATGAGGTTAGAGAACTCAGGAACTGTAGCCA
TATGTTTCACCGTGAGTGTATTGACCGGTGGTTGGATTATGAATGTTGCGGTGGTGATGA
GAATAACGAAGGTGAGGAGGATAATCACCGTACGTGTCCTCTTTGTAGAACTCCGCTACT
TGCTGCTAATACGACGTCGTGTGGTGATTGGCCGACGAAGAACGAACCTATGG
GenBank Accession BX291746 [GenBank]
Graphic View Graphic view of gene At5g20885
Predicted Position of Insertion Chr5:7084667 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F22D1
Hit Gene Code At5g20885 [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/U-box superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit MTH12

 
Sequence (A. th genome BLAST matches underlined)
>59-K019014-022-467-C08-8409
CTCTTAACCCTCATCTTTCCCTTGGCGAAGGGCTATGGGATCCTCCCTATACTGAGAGCN
CNNNCTTCCCATCNATGAGACTGACAAACCAGAACAATGTGTGGGAGCTTATAGATGCCA
AAACCCCAGAAGCCGTTGCCCTTTGTTGGTATGATTTGTTCTTACTGACCGTGAACAAAA
CAGA
GenBank Accession BX291747 [GenBank]
Graphic View Graphic view of sequence BX291747 of line 467C08
Predicted Position of Insertion Chr5:24040566 - go to primer design
BLAST e Value 1e-10
Hit Clone Code (BAC ID) MTH12
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 14.10.2014 10:23