SimpleSearch - Line and FST details


Line specific information

 
Line ID 468B03
Vector Used pAC161
Line Availability only available from NASC (N444847)
Segregation Analysis 50:49:43
Confirmed for Hit At5g57530
Parent of DUPLO pair none
Parent of pair(s) 6621, 6622, 6643, 8930, 10714, 11071, 11433, 82753, 82802, 82813, 82826, 82838, 82874, 82881, 82882, 82885, 82887, 82888

Gene hit F18G18

 
Sequence (A. th genome BLAST matches underlined)
>18-K019015-022-468-B03-8409
ATTTTACTAACAGATAACTTAATCAGCGACGTGAAAACGTCGACAAAACATATTTCATTC
ATCTATTTAATTTTCATTGTTTGATTTCTTATAGATCTATTAATTCGACACAAAACAGAG
ACCTCGATTTCATCTTTTTCGATCATCTACGTTTATGTTACTACCGGTTAAAATTTCTGA
GAATAATTAAAATTATAGAAGTGTTTTTACTGATCAATTAATGAAAAGGCTATGGGATCC
CTCCTTTTTATTAAGATACAAATGTCTTTACCGGAGGTAAAGGTAACCGCGAAATGCAGT
TCTATCTCTGGTTTGATCCCACTGCTGATTTCCACACTTACACCGTGCTTTGGAACCCTC
TCAACATCATGTAAGTAACCGATCAATCCTATTCAAGATAGACAAATATCGCTATGGGA
GenBank Accession BX291814 [GenBank]
Graphic View Graphic view of sequence BX291814 of line 468B03
Predicted Position of Insertion Chr5:8819321 - go to primer design
BLAST e Value 4e-121
Hit Clone Code (BAC ID) F18G18
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At5g57530

 
Sequence (A. th genome BLAST matches underlined)
>18-K019010-022-468-B03-8409
TATCCTGTNATTTCCCGGACTGAAGCCATTTACATTGAATATATGCAATCGCCTATGAGA
TCCACGACTATTCGCATTCCTATGGGATCCTCCCCATAAAGAGTCCCCAAGAGATATCTA
ACCTTGCCGTATAAACTTCCGGTGGCTACGCCTATCTATAACCGAATAGACGCCACCCAC
AAGGGAGACTGCTAGGTCGCAAAAGCCGACCTTCTATGCTGATGTTGCTAGCGGCGATGA
TGTTGGTGAAGACTAATTGTTATTCTAGATGTTTTGTATATTGCTGGATTTTGGAGATTA
TTTAGAGAGAGATTTTTTTTAATAATGAGTGCATTATAGAGGTTCGTGGAGTTCCATCAT
CGACATGGTCGTGTTACACTATGGGATCCTCCCTATAATGAGACACTTACACCGTGCTTT
GGAACCCTCTCAACATCATGTAAGTAACCGATCAATCCTATTCAAGATAGACAAATATCA
CTATGGGATCCTCCCTAT
GenBank Accession BX291813 [GenBank]
Graphic View Graphic view of gene At5g57530
Predicted Position of Insertion Chr5:23301382 - go to primer design
BLAST e Value 8e-36
Hit Clone Code (BAC ID) MUA2
Hit Gene Code At5g57530 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation xyloglucan endotransglucosylase/hydrolase 12
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03