SimpleSearch - Line and FST details


Line specific information

 
Line ID 470E06
Vector Used pAC161
Line Availability only available from NASC (N445078)
Segregation Analysis 50:27:14
Confirmed for Hit At5g11390
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g11390

 
Sequence (A. th genome BLAST matches underlined)
>45-K019032-022-470-E06-8409
TGATCTGAAATTTCCCGGACATGAAGCCTTTACAATTGAATATATCCTGACCTCCTCTAT
AGTGGGATGACATGAAAGCTATGACATGAAAGCTCATCCTCAGTGAATATGATTCTCCAG
AACGAGATTCAAAGCGCCCGTGTCATGATATCTCCGTTTCAACATGATGGAGAAGCTTTC
TTGGATTTGGAAGGGAAGTTGAATGATACTGAACAATCTTTGGGTCAGTTAATGGAACAA
GTAGTGGAAATGAAGAAGCAATCTTCTAACTTTCAGAGGTTATCTTCTGGTTTGGATGAA
CAAGGAAGCTGTAAGTGACCAACCTATGGGATCCTCCCTTATAGTGAGANNNNNNNNNNN
NTTTTTTTTTNCCCCCCCCCCCCCCTCNNNNNNTCTCNTTNCCCCNNCCTCTCCTCCCCC
CCCCCCCCAAAAAAAAAAAACNCCCCCCCCCCCCCTAATTTTCCCACTCTCCTATCCCCC
ACCACAAACCACTTCTCCCTTCCTCATAATCCTCTTCCAAATACAATCACATACAA
GenBank Accession BX293054 [GenBank]
Graphic View Graphic view of gene At5g11390
Predicted Position of Insertion Chr5:3634317 - go to primer design
BLAST e Value 4e-115
Hit Clone Code (BAC ID) F2I11
Hit Gene Code At5g11390 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WPP domain-interacting protein 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX293054 [GenBank]


Last Updated on 31.08.2016 09:40