SimpleSearch - Line and FST details


Line specific information

 
Line ID 470E07
Vector Used pAC161
Line Availability only available from NASC (N445079)
Segregation Analysis 50:47:46
Confirmed for Hit At4g11260
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g11260

 
Sequence (A. th genome BLAST matches underlined)
>53-K019032-022-470-E07-8409
TGTCCTGTAGATTTCCCGGACATGAAGCCGTTTTCTAATTTCCTTTTGATTTTATTTTTT
ACATAAGATTGATTCTTGATAAGTCCAGATTTTTTAACAAATAAATTAGTTGACAAAAGA
ATAATACTGAAAAAAGGAAAGAAAACTAATGGTAAAGATATTTATAGAGAACTACAATAA
TTTAAAATAATCATTTTCTACTCATTTTGTTTATATCGTAATCGTTTACTCATAGTTTAG
CAAATACAATGTGATTTGTGAATTTAGACTATGATATATTTTAACAAGTTATAATTTATA
TATTGACTATGGGATCCTCCCTATAGTGAGAGAGAANGNGCNGGGCGNTCCCCGGTTTTT
TTTTTTTNCCCCCCCCCCCCCCCCGAGAAGGATTATAAAAAGAGGGAAGGGGGAGGAAAC
AAAAAAAAAAAAAGGCCGGGGGGGGGGGGAAAGGAAAAAGCAGTCGGGGACAAAAAAAAA
AAACGGAAAGCAAACCCATGGCAAACACAAGAAAGGGAAAACCGCGAAAGACAGGGCGCA
AGCAGACGGGGGCAAGGGCAGAAAAGGAAAAAGTGAAGCAGGAGGAG
GenBank Accession BX293055 [GenBank]
Graphic View Graphic view of gene At4g11260
Predicted Position of Insertion Chr4:6853946 - go to primer design
BLAST e Value 2e-117
Hit Clone Code (BAC ID) F8L21
Hit Gene Code At4g11260 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation phosphatase-like protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40