SimpleSearch - Line and FST details


Line specific information

 
Line ID 471F06
Vector Used pAC161
Line Availability only available from NASC (N445186)
Segregation Analysis 50:48:45
Confirmed for Hit At3g18550
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g18550

 
Sequence (A. th genome BLAST matches underlined)
>46-K019878-022-471-F06-8409
ATGAGCATTTACACTTGATATATCCATTTACAAGGGAGAAAGTAAAAGCCTATGGGATCG
TCCCTATAGTGAGAACCTCTTTCCACCCAGAATACAATGGCCATGATGATAACCAAACCA
TCCCAAACGACAATCATCATCCATCACTTCACTTTCCCTTGAACAACACCATTGTAGAAC
AACCCACTGAGCCCTCGGAAACTATAAACCTTATAGAAGATTCCCAGAGAATCTCAACTT
CTCAAGACCCAAAAATGAAAAAAGCCATGAAACCCATCAGAACGGACAGGTACAGCAAGA
TCAAAACGGCCAAAGGGACACGAGATCGTAGGATGAGACTCTCACTATGGGATCCTCCCT
ATAGTGAGAGTTATGTGATACGCTCTAGTGTGAGATTGGCCGT
GenBank Accession BX531053 [GenBank]
Graphic View Graphic view of gene At3g18550
Predicted Position of Insertion Chr3:6383971 - go to primer design
BLAST e Value 2e-117
Hit Clone Code (BAC ID) K24M9
Hit Gene Code At3g18550 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation TCP family transcription factor
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03