SimpleSearch - Line and FST details


Line specific information

 
Line ID 471G11
Vector Used pAC161
Line Availability only available from NASC (N445203)
Segregation Analysis 116:36:18
Confirmed for Hit At2g34480
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g34480

 
Sequence (A. th genome BLAST matches underlined)
>87-K019878-022-471-G11-8409
ATTTCCGGACTGAAGCCTTTACAATTGAAAACCAAAAATATCCGATAAAATCCAAAACGG
GAGAGAGCACAGCTTCAACATCGATTCCACCCCAAAAAAGAGTCAATCAGAGACGTTTTA
CATGAACAAGTTGGGCTTGTTGGCCTTGTAAGTCGTCTTCAGCTTCCTGCTTGGTGGTCT
AACCTTGCGGAACACCAATGGGAACTTGATCTTGCTGTTGTGGAACTGTTTAGTGCTCTC
TCTCTTGCACAGCTTGGCTGGGACAGTGGCTGTCTTGATGATCTGAATGCAAGGGAATCT
GACACGGTGACGGGATGCCATCTCAGTGTACATCTGCTCAACAGCTCCGTTAAGAGTGGT
GTCACGGTACTCCTTGTACATGTTGTGGTACCCAGTTCTACTCTGGTACCTCAACCAAAT
ACCGAAGTTCTTGATCGTTGTTGGGTTCTTCTCATAGATCTGTGCAAACAATTTGGTAAT
AGATTACATTAGTCAAGAGAGGGGCCAAGGAGCAATCAAACAATATAAACTCATGATAAA
AACGTGATATGGTTTCAATTTCGATTCAATAGCAAGTCGAGAGAATCAAGTAAGAGACTT
TGGTGAATCTAAGTTTTCTCATTTGATGACAGACACAAATGAAAAGATTAACCTATGACC
CCCCCCC
GenBank Accession BX531076 [GenBank]
Graphic View Graphic view of gene At2g34480
Predicted Position of Insertion Chr2:14532822 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F13P17
Hit Gene Code At2g34480 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribosomal protein L18ae/LX family protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit F16F14

 
Sequence (A. th genome BLAST matches underlined)
>87-K019883-022-471-G11-8409
TGGGATCCTCCCTATAGTGACGATCTCTGGAATCAGCCCTATTCTGAGATATGGCATCCT
GTCTATACCGTTATGCCTCAACTAAACTATTTTATTTACAGAATACTTCTCATAGTGAGA
CCGACCGCTCACCTCTCAAAGTTGTGAATATGGAAAAGTAATCTTGTCCTTGATGAATGA
TCGTAACCACAGTTCTCTTCTAAATATGATTCTTAGGTTATTCGGTTGACTATCAACACT
GTAACGTTTAACGATTTGTTGAAACTTACTTTAGAAAAGTTGCCCATGTCATTTTTCTAT
GCAATGTTTTGGCAAATTATTCGATTAAATAAATTAGTTATCAGAGCTTTTGGTTATCTC
ATAAATTACTCAGATGACAAAAAAAAAAAATGGAATTTATTTTGTTTAAAAAAAAAAAAA
AAATTTCCCCAAAGGGGGAAAAAAAGGGGTTCCCCAAGGGGACCAGGGGCTGAAATTTTC
CTGCCCAAAGGGGAAAAGGGGGTTGGAAATTTTTTTGAAAATTCCCCGGAGTTAAAGGGG
GAAAAT
GenBank Accession BX531077 [GenBank]
Graphic View Graphic view of sequence BX531077 of line 471G11
Predicted Position of Insertion Chr2:7091702 - go to primer design
BLAST e Value 2e-113
Hit Clone Code (BAC ID) F16F14
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 14.10.2014 10:23