SimpleSearch - Line and FST details


Line specific information

 
Line ID 473A01
Vector Used pAC161
Line Availability only available from NASC (N445313)
Segregation Analysis 50:40:29
Confirmed for Hit MUB3
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit MUB3

 
Sequence (A. th genome BLAST matches underlined)
>01-K019789-022-473-A01-8409
TATCATGTAGATTTCCCGGACATGAAGCCATTTACATGTAGCATCTCTATTTTTCTTCAT
TCGAATTTCAAAAGTAAGTAAGTCATCCACTTCAATTCATAACCGAAAAATAAAAGTAAA
TTGATAGTATGTAAAAGTAAAACATTCTTTAAGAAAAATGAGATGTAAAATTTCACATAC
AAGATACAGTAAAGTGACCATGTGAATCTTTTTTGTTCATAAAAAATCATTTTGGTTAAT
CTATGGGATCTCNCCTAATAGTGAG
GenBank Accession BX531205 [GenBank]
Graphic View Graphic view of sequence BX531205 of line 473A01
Predicted Position of Insertion Chr5:25831180 - go to primer design
BLAST e Value 9e-33
Hit Clone Code (BAC ID) MUB3
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX531206 [GenBank]


Last Updated on 07.07.2016 14:03