SimpleSearch - Line and FST details


Line specific information

 
Line ID 475B01
Vector Used pAC161
Line Availability only available from NASC (N445517)
Segregation Analysis 50:23:15
Confirmed for Hit At4g16215
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g16215

 
Sequence (A. th genome BLAST matches underlined)
>02-K019271-022-475-B01-8409
CCTTAATCGATATTATGCTTACGGTTGATTGGTTAGCTCGGGAAAAGCATCTATGGGATC
CTCCCTATAGTGAGTCGTATTACTCAAAATGTGTGATGTTTAAAATATAACTATGGGATC
CTCCCTATAGTGACGTCGTATTACTCAGTGGATTCGATTCATATACGGACTGGAATATAC
TTTTTTACGGTTCACTATTGGATCCTCCATATCTATGGTATCCTTACTCAAGTGATNCGT
ATTACTCACATTCTAATTGATTGCCTATAGGATGATGTATTTATCAGATAAAGGAAGAGC
AGTTACATTTTTTGTCCTTCAAAATGGAGAGCTCGCAGCGTTATTATACANGCNCNAGGC
CGGAGANCTAGTGGATCGCGGTGGTATGATGGTCATATGGTAGACAAGAAAAAAAGTTCA
ATTTTTTGTCCTTCAAAATGTAGATCTCGCAGCGTTATTATAAAANG
GenBank Accession BX293097 [GenBank]
Graphic View Graphic view of gene At4g16215
Predicted Position of Insertion Chr4:9179649 - go to primer design
BLAST e Value 6e-09
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g16215 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX293097 [GenBank]


Last Updated on 31.08.2016 09:40