SimpleSearch - Line and FST details


Line specific information

 
Line ID 475E09
Vector Used pAC161
Line Availability only available from NASC (N445561)
Segregation Analysis 50:49:35
Confirmed for Hit At1g66470
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g66470

Sequence (A. th genome BLAST matches underlined)
>69-K019271-022-475-E09-8409
TGATCTGTAAATTTCCCGGACATGAAGCCTTTACGATTGAATATATCCGGACATGAAGTA
ATATAATAAATCTGTCATAAATGGTTATATGGATGTGTACCTTGGTGCCATTGGGAACAA
GTTCTTGCAATATCTTGAGACGTTCACTTATCCTTTCTCTTCGATTCTGAACAAAATAAA
ACATATGTAAATATGTGTTGAGAGATTGAGTTTTATTTTAATGAATGTAAATTAATGTCA
AGAAAGCAAACCTTGGCTGCTATGGGATCCTCCCTATAGTGAGCGGTATTACTCACACTT
TCTATTATTGCACTTAACACTTTTGATGCCGCCCTCAAAGCTTTGGCAACAAAGGACAAT
GTCACCTTAAATGTTAAGAGTCTCAGCAGCGATAACCGATGAAGACACATGTAAAGACGA
TTTGTCAAGTGTTATATCTATGGGATCCTCCCTATAGTGAGCCGGGATTACTCACGAGT
GenBank Accession BX293143 [GenBank]
Graphic View Graphic view of gene At1g66470
Predicted Position of Insertion Chr1:24796255 - go to primer design
BLAST e Value 2e-113
Hit Clone Code (BAC ID) F28G11
Hit Gene Code At1g66470 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ROOT HAIR DEFECTIVE6
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Menand et al. 2007, Atrhd6-3]

Gene hit T2J15

 
Sequence (A. th genome BLAST matches underlined)
>69-K019130-022-475-E09-8409
TGATCTGAAATTTCCCGGACTGAAGCCTTTACATTGAATATATCCGGACTGTCGGAACTG
ATACATCTGGTCTACTAGGATATATGGAAGAGTACCGTGGTGCCATTGCGAACTACTGCC
TGATTATCTTGAGACGACCCTTATCCTATCTCTCCTATTCTGAACGAAGAAACACATATG
TTTAGTACGTGTATGAGACATCGAGTTTCATTATACATGAATCGTGCATTTCTGATCACA
CAGCTAACCTTGGACTCGATCGCATCCTCACATATATTATGCCGAATATTCAGAACTTTC
TATTATTGCACTTACCAATTTTGATGCCGCCCTCAAAGCTTTGGCAACAAAGGACAATGT
CACCTTAAATGTTAAGAGTCTCAGCAGCGATAACCGATGAAGACACATGTAAAGACGATT
TGTCAAGTGTTATACCTATGG
GenBank Accession BX293142 [GenBank]
Graphic View Graphic view of sequence BX293142 of line 475E09
Predicted Position of Insertion Chr1:17709125 - go to primer design
BLAST e Value 3e-82
Hit Clone Code (BAC ID) T2J15
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 07.07.2016 14:03