SimpleSearch - Line and FST details


Line specific information

 
Line ID 476A11
Vector Used pAC161
Line Availability only available from NASC (N445611)
Segregation Analysis 50:40:28
Confirmed for Hit At5g27420
Parent of DUPLO pair 2466
Parent of pair(s) none

Gene hit At5g27420

 
Sequence (A. th genome BLAST matches underlined)
>81-K019131-022-476-A11-8409
GGCTTTTCTTAGAAACCCATCGATTCTCTGGAGGAATACGACGCCTGTTCCTTCGCCGAG
AGTTGAAGTCATTAATAAGGACGGTGAAGGAACATCGTCAGTTCAACATATCGGAACAGT
TGGTTCAACTATGGGATCCTCCCTATAGTGAGATTTTCTGATTTGACCTCTACAAATTTG
ACATTATATTATTCTTCTGAGATATACATTTCTTGATTCTCATTATTTGTGCATTGCCTT
CTCCTATTTATACAACGGTTCCCAATTTCTCGTTGTATCTCAATGTACTTTCTTTTTATA
TTAACGCTGCCCACATCTACATTTTTGAATAGAAGAAAATCGTGAGTTACTCTTTCTTTT
GenBank Accession BX293186 [GenBank]
Graphic View Graphic view of gene At5g27420
Predicted Position of Insertion Chr5:9685057 - go to primer design
BLAST e Value 2e-58
Hit Clone Code (BAC ID) F21A20
Hit Gene Code At5g27420 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation carbon/nitrogen insensitive 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX293186 [GenBank]


Last Updated on 31.08.2016 09:40