SimpleSearch - Line and FST details


Line specific information

 
Line ID 479D02
Vector Used pAC161
Line Availability available as T3 set from NASC (N445926)
Segregation Analysis 100:52:30
Confirmed for Hit At3g25410
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g25410

 
Sequence (A. th genome BLAST matches underlined)
>12-K019034-022-479-D02-8409
TGAAGCACTTACATGATCCAATTAGAAGACACTAAGCAAAGGGTGTAAAGATACAGAAGC
AATAGTTGTAGAACTATGGGATCCTCCTTATAATGAGACCC
GenBank Accession CR770398 [GenBank]
Graphic View Graphic view of gene At3g25410
Predicted Position of Insertion Chr3:9215277 - go to primer design
BLAST e Value 3e-14
Hit Clone Code (BAC ID) MWL2
Hit Gene Code At3g25410 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Sodium Bile acid symporter family
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37