SimpleSearch - Line and FST details


Line specific information

 
Line ID 480C06
Vector Used pAC161
Line Availability only available from NASC (N446014)
Segregation Analysis 50:23:18
Confirmed for Hit At5g57180
Parent of DUPLO pair 2449
Parent of pair(s) none

Gene hit At5g57180

 
Sequence (A. th genome BLAST matches underlined)
>43-K019791-022-480-C06-8409
ATTTCCTGCACGTATTTTGAAGAATAATTACTCTAACCCTTTGACTTTGGTACATAGTCT
TCTTTTTATTATAAATAACATTTTTTTCTGTGATGACTTTCAATCAATTAAGAAAAAAAA
AAGCTGCTTTTTATTTGTCCAATGAAAACTTTATAAACTGGGCCCGAGAATTTTCACGTA
AAGAATAAATGAGGGGGTTCAAAATTTATTTTGCAAATGTCCGCTACCCCAAAAACTCCT
TTTAACATAAAGTCTATGGAATCCCCCCCAATATCGAGAACGCCGAAGTAATCAAGCTTC
AACAACGGACCTGTTCTCTTCAAACTCGTCTCCTCCGTATCTTCCAAGCTTTTCGATTCC
GTAATCAATGTCGTCGTCACCGTCATTTTCTTCTTCTTCTTCTTCTTATTACTCTTCTCT
CCAGAGATTACCACCTTCTTACCGTCGGATTTCTCCTCATCAACGGTGGAGATTGCAGTT
TCGGTTTTGACAGTTTGAATTCGCGGCGAGATCTGTTCGAAATCAACGGGATGAATCTTC
CACAATTTTGTGTCGTCGTTTTCTCTGAGAGCACTTCGTAATCCAAGCCCTAACGGGAAA
TTGAATCCGGTAGAGCTTCGATTCCATGAATTGATCTCCATCATCTGTGCTATGGGACTC
CCCCATAAAGGGGAGGGGGNGGGGATNTGGGCGCGGGAGAAGAAAGAGGGAAGAAACAA
GenBank Accession BX531431 [GenBank]
Graphic View Graphic view of gene At5g57180
Predicted Position of Insertion Chr5:23169668 - go to primer design
BLAST e Value 2e-116
Hit Clone Code (BAC ID) MUL3
Hit Gene Code At5g57180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation chloroplast import apparatus 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX531431 [GenBank]


Last Updated on 31.08.2016 09:40