SimpleSearch - Line and FST details


Line specific information

 
Line ID 481D09
Vector Used pAC161
Line Availability only available from NASC (N446125)
Segregation Analysis 50:16:10
Confirmed for Hit At4g18230
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g18230

 
Sequence (A. th genome BLAST matches underlined)
>68-K019880-022-481-D09-8409
TGATCCTGAAATTTCCCGGACATGAAGCCTTTACATTGACACGAGTGTATTATTTTGATT
CTTCAGCAGCTTATAATCGCCGAGTTGAATGCTTCATTTCACTATTTTGTTCATCTTCGA
GCTACGATTTTCACGATTCCTTGTTGATGCGATCTGATTTTGAGATGGATCTCCCTTACA
CTCGGTTTTTTACGGTTTATATCGCAGATGGACAACGAGTCATGGAGGAGGTTTGCGCTT
GTGATTTACTACAGAGAGGGTCTCAACTATGCTGATTTGGTATATTGCTTATTTGGGAGA
TCTCTCTTCTACTGGCTCGAGTACTGTATGCCATATACCGATGGGGAAATCCACTTCCGG
GAGGATCTTCACAGTCGTGAACTACTCTTATTGTTCTTGGTTCTGGTAAGAAGAGTTAAT
GCAGTGTCTTCTTCAATTGGATCTAAGTAATGGTGCTGCATATTATGATATGTTATTGTG
GGGTTTTTGTTAATCACCAGGGGGACACACAGCAGAGATGTTGAGTCTCCTCTCTGTTTT
GCGGAAGGATAGATTTACACCAAGGTTTTACATTGCTGCTGCTACAGATAACATGAGTCT
CCAGAAAGCTCGTAGTTTTGAAGATTCCCTATGGA
GenBank Accession BX531548 [GenBank]
Graphic View Graphic view of gene At4g18230
Predicted Position of Insertion Chr4:10081876 - go to primer design
BLAST e Value 2e-144
Hit Clone Code (BAC ID) T9A21
Hit Gene Code At4g18230 [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX531549 [GenBank]


Last Updated on 14.10.2014 10:23