SimpleSearch - Line and FST details


Line specific information

 
Line ID 481E12
Vector Used pAC161
Line Availability only available from NASC (N446140)
Segregation Analysis 50:3:2
Confirmed for Hit At1g59830
Parent of DUPLO pair none
Parent of pair(s) 4731, 4738, 8509, 10083, 83714, 83715, 83716, 83717, 83718, 83719, 83722, 83723, 83724

Gene hit At1g59830

 
Sequence (A. th genome BLAST matches underlined)
>93-K019880-022-481-E12-8409
TGATCTGAAATTTCCCGGACATGAAGCCTTTAAATTGAATATCTCCGGACTGATCCCGAC
GATCGTTGTGGATGGGGAATATCTCCTCGTGGTGCTGGTTACACCTATGGACAGGACATT
GCTACTCAATTTAATCATAACAATGGACTGAGTCTGATCTCAAGAGCGCATCAACTTGTA
ATGGAAGGCTATAATTGGTGTCAGGTATATAATATGTGCATAACAATAGATTGGCATATG
TGTTGAATAGGGTTCTGGTTGCAAAAATGCTGAATCTTTCGGTGTGTTGATAGGAAAAGA
ACGTAGTGACAGTGTTTAGTGCACCGAACTACTGTTACAGATGTGGAAACATGGCCGCAA
TTCTTGAGATTGGAGAAAAGATGGAACAGAACTTCCTTCAATTCGATCCAGCACCTATGG
GATCCTCCCCATAAGTGAGAGCNCNNGACCCCTGATTATTTTTTGTGATTTCATTTTTTT
TCTTCCAAAGTTTGCTTGTTGCTGTATCATTGAAGATGTGTCTG
GenBank Accession BX531570 [GenBank]
Graphic View Graphic view of gene At1g59830
Predicted Position of Insertion Chr1:22021125 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F23H11
Hit Gene Code At1g59830 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation protein phosphatase 2A-2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX531571 [GenBank]


Last Updated on 31.08.2016 09:40