SimpleSearch - Line and FST details


Line specific information

 
Line ID 482D07
Vector Used pAC161
Line Availability only available from NASC (N446219)
Segregation Analysis 50:10:10
Confirmed for Hit At2g45910 At3g27190
Parent of DUPLO pair none
Parent of pair(s) 425, 4032, 4227, 9929

Gene hit At2g45910

 
Sequence (A. th genome BLAST matches underlined)
>52-K019793-022-482-D07-8409
TGATCTGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATGATGACTTCAAAATG
ACTTGCACGAATCAGCCAGTGCGTAATTATTACTCTATGGGATCCTCCCTATAGTGAGAG
ACAAGCATGGCTTTCCTGGACTTCAGATCCGTGCATTCTCCTGAAAGCCAAAGATTGATA
GAGGAAGCAAAACATAAGGATATTGAAGAGTAAGAAGCACACAGATCTACCGGAGCTGAT
TCAGCATGAATAAGCATAGATCCCAAAAAATGCTTAGTGACTCGCCATAAGCATACCTTG
AATAGTGTCGATCTGCTGCTGCTCCCATGACAAGTATCCTGATTCCCAGCTCCGAGATGA
GCTGCACAATTCCATTCTCGATGGATGCCATTTCAATAAACATCTTTGCTGCCCTGACCT
CCTCCTTATATACACTATCTATCATAAGGACACTATAATCGTAGTGCTATGG
GenBank Accession BX531659 [GenBank]
Graphic View Graphic view of gene At2g45910
Predicted Position of Insertion Chr2:18895487 - go to primer design
BLAST e Value 6e-148
Hit Clone Code (BAC ID) F4I18
Hit Gene Code At2g45910 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation U-box domain-containing protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g27190

 
Sequence (A. th genome BLAST matches underlined)
>52-K019801-022-482-D07-8409
TGATCTGAAATTTCCCGGACTGAAGCCATTTACATTGAATATGGATGACTGCACATGGAC
TTGTACGAATCATGCACTGCCTAATTATTACCCTATGGGATCATCCCTATAGTCGAGAGA
GTACCACACACAAAAATACTGAGAACAGGGACGGGTACAGAATCTAACCTGGTTAACTAA
AACAATGCGATGATCATGAAGTTGCTGGATTATCATGTCACATACCGTCGTCTTACCAGA
AGCTGTACCACCAGTAACTCCTACACAAGTCAAAGGAAAACATGTTCAAGTAAATCAAAG
GATTAGACCCTATGGGATCCTCCCTAATAGTGAGATTCCTGATTCCCAGCTCCGAGATGA
GCTGCACAATTCCATTCTCGATGGATTCCATTTCAATAAACATCTTTTCTGCCCTGACCT
ACAATCATAAATACACTATCTATCATAAGGACACTATAATCGTAGTACTATGGGA
GenBank Accession BX531660 [GenBank]
Graphic View Graphic view of gene At3g27190
Predicted Position of Insertion Chr3:10042259 - go to primer design
BLAST e Value 8e-104
Hit Clone Code (BAC ID) K17E12
Hit Gene Code At3g27190 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation uridine kinase-like 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03