SimpleSearch - Line and FST details


Line specific information

 
Line ID 483D04
Vector Used pAC161
Line Availability only available from NASC (N446312)
Segregation Analysis 100:59:42
Confirmed for Hit At1g63650
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g63650

Sequence (A. th genome BLAST matches underlined)
>28-K019729-022-483-D04-8409
ATGATCATTTACCATTGATAGATACTCATTTTATTGGAAATAAGTTTTTACTTCATTTGC
ATAATTGCATTATACATTTGCTATTCAAAGAAAGTAGTAGAAAACTTTTGTTCCCATTAA
GATAAAGATTTTGAGATACAAAACATAAAGGGTATTTCCGTCTTTCTAATGTAGAATCCC
CGGAGGAGCGTTATCCAATGGAGAACCAATATGGCTTTGTAACGCTGAAACCGCCGATAG
CAAAGTCTTCACTCGTTCTCTTCTATGGGATCCCCCCTATAGTGAGATGTAAAAACGATA
TCCTTCTTAAAAGAAATTTTTCTGAAAGATAGGTTTTTGTTTTTAAAAAAGGTGAAATGA
AAGGATTATGAGGAAGAGACGGAATTACCCTTCCCCGATGTTGAAGACGAAAGACATGCT
TACTAAGTAGTACCACTCGGTGTCAGTGAGGTCCTCCCGAGAAAGAGCGGGGGGGGAAGC
TCGTCTATGGGACCCTCCCTATAGGGGGGGCGGGGCCGGGCGCGCCCCGAGAACCATCGC
GCGATACGCCGCCGGGAGTCACCCCCGGAGGCCGCGTTAACGAGCCCCGGCGTACTCGGC
CCCGTAAGTGGGGACTATAGAGTGGCACTACAGCAGCGAAATCCCGTTTGAGGTACAAAG
ACCCCTACCGAAGAGGAGAGAGAAAGA
GenBank Accession BX531737 [GenBank]
Graphic View Graphic view of gene At1g63650
Predicted Position of Insertion Chr1:23600798 - go to primer design
BLAST e Value 4e-127
Hit Clone Code (BAC ID) F24D7
Hit Gene Code At1g63650 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Appelhagen et al. 2011, egl3-gk]


Last Updated on 31.08.2016 09:40