SimpleSearch - Line and FST details


Line specific information

 
Line ID 484D08
Vector Used pAC161
Line Availability only available from NASC (N446412)
Segregation Analysis 100:67:63
Confirmed for Hit At2g35940
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g35940

 
Sequence (A. th genome BLAST matches underlined)
>60-K019730-022-484-D08-8409
TTGATCCTGATGAATCCAACTACTCACGATCGGTTCACCCAACCAGATAACGACTCGAAT
GATATGAACTACTGCATCTATAGCGACAACAACAACACAAACACGGACACAAACAACAAC
AACAGTAGTTTCGTTTTCCTCGATTCCCACGCGCCGCAGCCAAACGCGAGCCAGCAGTTC
GTCGGAATACCACTCTCAGGTCACGAAGCTGCTTCCATTACAGCCGCCGACAACATCTCC
GTACTTCACGGTTATCCTCCGCGCGTGCAGTACAGTCTCTACGGGAGCCACCAAGTGGAT
CCCACTCACCAGCAAGCCGCGTGTGAGACGCCACGCGCGTATCAAGGCCTCTCTATAACC
CTCTCGTCTCAACAGCAGCAGCAACAGCAACATCATCAACAACACCAGCCTATTCACGTC
GGATTCGGGTCCGGACATGGAGAAGATATCCCGGTCATGTCTGGCTCTACAGGATCGGGG
GCAACAAACGGTATAGCCCACCCCGGTACCTCCAAGTAATTGAAGGGGGCACACGAGCCT
CTTGGCGAAGTAGTCAAAGCTTGATCCGATGACATGACCGCCTAGTCCCACCTATTCTCA
TTGAAAAGAGGTAGTTGGGGAAATGTTAAAACCTTTCGGAAAATCCCCGGCCGGAGGCGG
GAAGAACAAGCTCCCGTGGACGAAACAAAACAAACTG
GenBank Accession BX531844 [GenBank]
Graphic View Graphic view of gene At2g35940
Predicted Position of Insertion Chr2:15091744 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F11F19
Hit Gene Code At2g35940 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation BEL1-like homeodomain 1
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit T2H7

 
Sequence (A. th genome BLAST matches underlined)
>60-K019737-022-484-D08-8409
TATGGGATCCTCCCTAAAGTGAGTATGGGATCCTCCCTATATTGAGTAAATCCCCCTAAT
AGTCATGATTTACACTTTACGAGTCCCTAACCAAATATCATCCGTTACTCAAATCTCCGT
CTTTACTGGTTCTTTTAGTTACCAATAATCACACAAGACCCATTTTGAAACAAGGCCGTT
CATTTTATTTGATCAATATAGTATACAATTTGTAAACAGAAATTATATTCTTTAACATTC
AACTAAATTTTTTCATAATTTGACGTGAATAGTCAAGAACTTAAACAATAATTAAACTCA
TAACTACAAAACCTATGGGATCCTCCCTTATAGTGAG
GenBank Accession BX531845 [GenBank]
Graphic View Graphic view of sequence BX531845 of line 484D08
Predicted Position of Insertion Chr1:10597637 - go to primer design
BLAST e Value 2e-151
Hit Clone Code (BAC ID) T2H7
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 07.07.2016 14:03