SimpleSearch - Line and FST details


Line specific information

 
Line ID 489A08
Vector Used pAC161
Line Availability only available from NASC (N446856)
Segregation Analysis 50:38:25
Confirmed for Hit At2g42440
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g42440

 
Sequence (A. th genome BLAST matches underlined)
>57-K019637-022-489-A08-8409
TGATCATGAGATTTCCCGGACATGAAGCCTTATATCGATAATTGAGATATGGCACTAACA
ACTAAGCTACTGATAGTATAAAGTAAACAGGCACTGAATCCTACCTTCATCATATTATAC
CAATTCATTACTCACTGGAAAATGTCCCGGATTTGCGATTACTACACGCGGGACATGCAT
CCTAAAATAAATACGTGCCTTCACTATCTTACTATCACTCTAGCATGGACGCTCGTTCAC
CAAGAAGATTCTTGTTAAAAAAACTGAACGACACGAGGCCTAGGATCCGAGCGCGCCCTC
TCTATTCGCTATGGGACCGCCTTTCTCGTGAGGCAGCAATTCACCAAGTGTTTGGAGCCA
GCAATGCTTCTAAATTGCTCTCTCATCTTCCCATGGAGGATCGACGTGAAGCCGCTACTA
CAATCTATTATGAAGCTCAAGCTCGCCGTCAAGACCCCATCTATGGCTGCGTTTCTCATA
TCTTTTCCCTCCAACAACAAGTAAATATATAAAACTTCCTCTATTTAACCCTATGG
GenBank Accession BX532211 [GenBank]
Graphic View Graphic view of gene At2g42440
Predicted Position of Insertion Chr2:17669913 - go to primer design
BLAST e Value 9e-110
Hit Clone Code (BAC ID) MHK10
Hit Gene Code At2g42440 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Lateral organ boundaries (LOB) domain family protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX532211 [GenBank]


Last Updated on 31.08.2016 09:40