SimpleSearch - Line and FST details


Line specific information

 
Line ID 491A12
Vector Used pAC161
Line Availability only available from NASC (N447052)
Segregation Analysis 50:24:19
Confirmed for Hit At4g13000
Parent of DUPLO pair 2800
Parent of pair(s) none

Gene hit At4g13000

 
Sequence (A. th genome BLAST matches underlined)
>89-K019646-022-491-A12-8409
AAACGGCGAGGCTCCGTACAACATCTGATACAAAACCACTCCCAACCACGGCCAATCCAC
GGCAAACTCATGGCCACTTCCGGTGATTACCCTCGGTAGAGCATGTTCCTCTGTTCCAAC
AAACGAGTTCGACTTCTCTCCTGAAAACTCCGACTCGGAGGATCTCGAAACCGAGTCGTC
CGGGGAGATTCCGGAGTTACATAAACCGGAAAATGCGAAGATAGACCTTTCTTTCTTCGT
CGCCGTCGAAAGTCTCGGTGACGACGAAAAAGAAGATTGTGGAGTTCTATGGGATCCTCC
CTATAGTGAG
GenBank Accession BX532403 [GenBank]
Graphic View Graphic view of gene At4g13000
Predicted Position of Insertion Chr4:7598333 - go to primer design
BLAST e Value 2e-126
Hit Clone Code (BAC ID) F25G13
Hit Gene Code At4g13000 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03