SimpleSearch - Line and FST details


Line specific information

 
Line ID 491F12
Vector Used pAC161
Line Availability only available from NASC (N447112)
Segregation Analysis 50:38:28
Confirmed for Hit At5g45840
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g45840

 
Sequence (A. th genome BLAST matches underlined)
>94-K019646-022-491-F12-8409
TGGGATCCTCCCTATAGTGAGATGGACCAGTCTCGCCAGTCTTCCATGGAACTAGTACTC
TTCACGGGTCATTTCCGGAAGACTAATATAACCGCTACTATTATCACCATCGCTACGAGA
GCAACAACACCGATCGCAACAGGCAACCAAACGTCCTGAGACCCTTTCGATTTTTCTGCG
AATTTCCTCGGAGGATGACTATGGGATCCTCCCTATAGTGAGATTTTCGGAGACGCTCCT
CGGGGGTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTTCAACAATGGCCTT
TCCTTTATCGCAATGATGGCATTTGAAGGAGCCACCTTCGTGTTCCACTATCTTCACAAT
AAAGTGACAGATAGCTGGGCAATGGAATCCGTAGGAGGTTGCCGGATATTACCCTTTGTT
GAAAAGTCTCAATTGCCCTTTGGTCTTCTGAGACTGTATCTTTGATATTTTTGGAGTAGA
CAAGCGTGTCGTGCTCCACCATGTTGACGAAGATTTTCTTCTTGTCATTGAGTCGTAAGA
GACTCTGTATGAACTGTTCGCCAGTCTTTACGGCGAGGTCTGTTAGGTCCTCTATTTGAA
TCTTTGACTCCATGGGAATTGGGGATCCTCTATGGG
GenBank Accession BX532468 [GenBank]
Graphic View Graphic view of gene At5g45840
Predicted Position of Insertion Chr5:18595475 - go to primer design
BLAST e Value 1e-43
Hit Clone Code (BAC ID) K15I22
Hit Gene Code At5g45840 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03