SimpleSearch - Line and FST details


Line specific information

 
Line ID 493A10
Vector Used pAC161
Line Availability only available from NASC (N447242)
Segregation Analysis 100:91:70
Confirmed for Hit At2g02810
Parent of DUPLO pair 151
Parent of pair(s) none

Gene hit At2g02810

 
Sequence (A. th genome BLAST matches underlined)
>73-K019652-022-493-A10-8409
TGATCTGAAATTTCCCGGACATGAAGCCATTTACATTGAATATATTCATGCCGCTATCGG
GATCATCCCTATATGGAGCACGGCACCGCATATACTATACTTTAGAATGGCCCTTGCCGC
TTCCAGGGGTAGCTTACATAACTCAATTGCTTTGAATCATATCCCTTGTGGCAAGCCTGA
CATGAAGATCATGTTGTATATTGTGCCCCATAAGATCTTTCCCACCATTATGTCCCACGC
TCCTGGTTACCGGTACCTATAAAAATTCTTTGCGTGGTGACTTGATCAAAGATCGGAATA
ATGGAAGTTCTATGATCTGTCGCAATGTCTCATCTATATATACCTTGAGGCACTGAAGTC
TTGTGTGGCATTTGCGAATCCGTCACAGGCGATGTTTAATGAACAAAGTGCCTCACCTAC
GCGAGCATTTGGATGTGCTATAGCATCCTCCCTAATAGTGAGAGACAAGCGCGTCGAGCT
CCACCATGTAGACGAACATGTTCTTCTTGTCATTGAGTCCTAAGATACTCTGCATGAACT
GTTCGCCAATCATAACCGCGAGTTCTGGTACGTCCTCTATTTGAATCTTTGACTCCATGG
CAATTGGGGATCCTCTA
GenBank Accession CR770404 [GenBank]
Graphic View Graphic view of gene At2g02810
Predicted Position of Insertion Chr2:803078 - go to primer design
BLAST e Value 3e-103
Hit Clone Code (BAC ID) T20F6
Hit Gene Code At2g02810 [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-galactose transporter 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR811072 [GenBank]


Last Updated on 14.10.2014 10:23