SimpleSearch - Line and FST details


Line specific information

 
Line ID 493B02
Vector Used pAC161
Line Availability only available from NASC (N447246)
Segregation Analysis 50:37:30
Confirmed for Hit At4g16420
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g16420

 
Sequence (A. th genome BLAST matches underlined)
>10-K019652-022-493-B02-8409
ATTTCTCGGACGGACTTCTGAATAATATTAGTAGAGATCCAAAACCTCACAAATTTCGAC
CGAGTTTTGTTGAATTCCGATTAGATCTTTCTTCCACGAAACCCCCCCAAGTACCCATTC
CATCTTCTCCGGTGAGTCTCCCATGTTGGCATTACGCTATGGGATCCTCCCTATAGTGAG
ACTATGGGATCCTCCCTATAGTGAGGGTATGGGATCCTCCCTATATTGGGCTACACTGAA
TTGGTAGATCTATGGGATCCTCCCTATAGTGAGAGGAAAATGAGTTCTTTTCTTTCGGCT
ATATATAAGACTGAACTTTATTTGTCATTATATCAAAGTGAACTTTCCTTTTATAATAGC
GCTGGGGATATCTACATTTTTGATTTGAAAAAAAATTGAGAATTACTCTCTCTTTGTCTC
CATATAGACCCTCACACTCTTTGGTGATCGATGGAAATNCCCCGG
GenBank Accession BX532614 [GenBank]
Graphic View Graphic view of gene At4g16420
Predicted Position of Insertion Chr4:9265981 - go to primer design
BLAST e Value 2e-64
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g16420 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation homolog of yeast ADA2 2B
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX532613 [GenBank]


Last Updated on 07.07.2016 14:03