SimpleSearch - Line and FST details


Line specific information

 
Line ID 493E02
Vector Used pAC161
Line Availability only available from NASC (N447282)
Segregation Analysis 50:43:40
Confirmed for Hit At4g27060
Parent of DUPLO pair 2440
Parent of pair(s) none

Gene hit At4g27060

 
Sequence (A. th genome BLAST matches underlined)
>13-K019652-022-493-E02-8409
TGATCTGTAGATTCCCGGACATGAAGCCATTTACATTGGAATATCTCTTGCCATGCCTTC
ACAATCCTTTCTAAACCCCTTACTCTGACCTCCAAGGTCACCATACTGTCATGTGAGCCA
CCAATAAACTCTTGGAGCATGTTCATAACATTAGTTTGTTGTCTCTCTATGGGATCCCCN
CTATATAGAGTACTTATGCTTTTAATAACCAGATCTGTTATAAAATGTTATACACACTAA
TTCACCCTTCAACGCTTTATATATCTACTAAGAAAGGCTGTTATAGCTCGCACCTTAATG
GATCTGTGCAGGCTATGGGATACTCCCTATGATACTAAAACCGCAACCGAATCTTAAAGG
CTGAATAATTGTATCCTTGATAGAAGACACAAAGCCAAAGACTCTTATGGACTTTGGCTA
CTCCATGACAGCTTTGAGAATCAAGAAGAACGCTGGCTATGGGATCCTCCCAATATCGAG
ATATATATCAGAGTTATAACAGCATTTATTAAATCAGTATGGGTGATTTATTCTATATTC
TGCATAAAATATGTAATATTTTTAGCATCTTTTTTTTTTT
GenBank Accession BX532661 [GenBank]
Graphic View Graphic view of gene At4g27060
Predicted Position of Insertion Chr4:13582593 - go to primer design
BLAST e Value 7e-52
Hit Clone Code (BAC ID) T24A18
Hit Gene Code At4g27060 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ARM repeat superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23