SimpleSearch - Line and FST details


Line specific information

 
Line ID 495F02
Vector Used pAC161
Line Availability only available from NASC (N447486)
Segregation Analysis 50:3:3
Confirmed for Hit At3g54340
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g54340

 
Sequence (A. th genome BLAST matches underlined)
>14-K019654-022-495-F02-8409
TATTGCTTCATATTTTCTCTTGTAGGTTACACCATTGCAGAACAGAAGTCAACAAGACAT
ACAAAAGAATCTCATACATGAGCTGGTAATATCTCTTTCTGTTTTTCTCAAATGTTGGTT
TAGGCATAATACATTCATGGAATACGGAGCCAGTTAAAAAGATATCTATGGGATCCTCCC
CTATAGTGAG
GenBank Accession BX532872 [GenBank]
Graphic View Graphic view of gene At3g54340
Predicted Position of Insertion Chr3:20120020 - go to primer design
BLAST e Value 2e-73
Hit Clone Code (BAC ID) T12E18
Hit Gene Code At3g54340 [TAIR] [MIPS] [SIGnAL]
Gene Annotation K-box region and MADS-box transcription factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23