SimpleSearch - Line and FST details


Line specific information

 
Line ID 498A09
Vector Used pAC161
Line Availability only available from NASC (N447721)
Segregation Analysis 50:42:39
Confirmed for Hit At3g02885 At2g46810
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g02885

 
Sequence (A. th genome BLAST matches underlined)
>65-K019699-022-498-A09-8409
AAACTTCTTTTTAGATATATTTGATAATATTCACCTATGGGATCCTCCCTATAGTGAGAC
TACTCTGTTTTAATCTGTTCCTACGAGTTGGCGATTTGTCTCTAGAGCTGTTTTTGTGGC
TTTTGCTCTTAACTGTCGTGTTTGTTATACGTGTGAGCCCGCCCAATGTGTCTTGGCCGA
ACTTAATGTGGAAACATATTTATGAACATGGGCTCTCTTTATCAATTGATTTGAGCCTAC
TACTATGTATGCATGAAGCCCGTGAAGTAGCAATCGCGAATATTTCATTCATAAGATATG
ATTTTCTATATCGATGATTCATCCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX533127 [GenBank]
Graphic View Graphic view of gene At3g02885
Predicted Position of Insertion Chr3:638394 - go to primer design
BLAST e Value 1e-59
Hit Clone Code (BAC ID) F13E7
Hit Gene Code At3g02885 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GAST1 protein homolog 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g46810

 
Sequence (A. th genome BLAST matches underlined)
>65-K019684-022-498-A09-8409
TGATCTGTAGATTTCCCGGACATGAGCCATTTACACGAGACCATTTCCTAGGTCGCTGCC
TGTTATATCCATACGTGCCCTTGTTAATTCTACTGGTAGACCAGACTGAGGCCGCCTCCC
CTAGACCGAGAAACTTCTTTTTAGATATATTTGATAATATTCATCTATGGGATCTCCCCT
ATAGTGAGACCCTGCGGGGNAACTCCTTCCCCTGTTTTGTCTATTGGTGCCCTGACTGGA
CCTTGAGGCTGTTGCGCGAAGCAGCCTAGTAGGTCATGAAAGTGTACCGGACCATCGAGG
CTTGGCCCTTGAAGAGGAGGAACACACATCTCTCAACTGCGATCTTGCTGCAAGACGACT
CGAGCCCACTTCTACGTATGCTGCAAGCCCATGAAGACCCTTCTGCGTTTTTGTCATTCA
AAGACCCGAGCTT
GenBank Accession BX533126 [GenBank]
Graphic View Graphic view of gene At2g46810
Predicted Position of Insertion Chr2:19240994 - go to primer design
BLAST e Value 4e-10
Hit Clone Code (BAC ID) F19D11
Hit Gene Code At2g46810 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03