SimpleSearch - Line and FST details


Line specific information

 
Line ID 498B04
Vector Used pAC161
Line Availability only available from NASC (N447728)
Segregation Analysis 50:50:341
Confirmed for Hit At3g11320
Parent of DUPLO pair none
Parent of pair(s) 2531, 97132, 97133, 97134

Gene hit At3g11320

 
Sequence (A. th genome BLAST matches underlined)
>26-K019684-022-498-B04-8409
TGGGATCCTCCCTATAGTGACGATTATGAGATCTGCTATATCGCGTGTGTGATACGTGAA
TTTCAACACTTATAGGGATACCCCCCTATAGTGAGATCTTCACTCTCGTCCCTGTTGTTA
CCGGTGTTGTCATGGCCAGCGGGGTAATTGCCTTTTAAATTCGAAATCTGCTCTTTGCTT
TTTGTATGTTGAAGAAATGTGCTTGTTCATAACTGATGAAATGTGTAGCTTTAGGGAGAT
GGGAATGTGATGCAGGAATACAAGATTCTGAGCTGAATCTGCTTTGTCTGATTCATTTTG
GATGATGATAGAAATCGTAGGTAACATTTATGGAACAAGGATACGATGGTGTATTATACC
TTACAAACATCCTTGGGATTTGCCTGAGCTTGATCACTTCATGATATGTACTTTATATGC
TGCTCACATTAGGCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX533134 [GenBank]
Graphic View Graphic view of gene At3g11320
Predicted Position of Insertion Chr3:3548222 - go to primer design
BLAST e Value 1e-158
Hit Clone Code (BAC ID) F11B9
Hit Gene Code At3g11320 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Nucleotide-sugar transporter family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX533134 [GenBank]


Last Updated on 31.08.2016 09:40