SimpleSearch - Line and FST details


Line specific information

 
Line ID 498G06
Vector Used pAC161
Line Availability only available from NASC (N447790)
Segregation Analysis 50:50:36
Confirmed for Hit At5g09810
Parent of DUPLO pair none
Parent of pair(s) 5251, 5322, 5337, 5389, 8636, 86119, 86129, 86138, 86147, 86148, 86149

Gene hit At5g09810

 
Sequence (A. th genome BLAST matches underlined)
>47-K019699-022-498-G06-8409
GTTCCCAGGAATGCTGAGCGTATGAGCAAGGACGATCACCGCTCTTGCACCTATGGGATC
CTCCCTATACGCTGTAGATGATATCGACTCACATTATCATGATGGAGCTGGAAGTTGTTT
CATGGATTCCAGGAGCTTCCGTTCCGATGAGCGATGGCTGGAACAGAACCTCAGGACAAC
GGAATCTCTCAGCTCCGATGGTTATGACTTGTCCATCAGGTAGCTCGTAGTTCTTCTCCA
CTGAAGAACTGCTCTTGGCTGTCCCTATGGGATCCTCCCCTATAGTGAGAGAATTGGAAT
TATCTCTTTCTTTGA
GenBank Accession BX533205 [GenBank]
Graphic View Graphic view of gene At5g09810
Predicted Position of Insertion Chr5:3053900 - go to primer design
BLAST e Value 4e-84
Hit Clone Code (BAC ID) MYH9
Hit Gene Code At5g09810 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation actin 7
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX533205 [GenBank]


Last Updated on 31.08.2016 09:40