SimpleSearch - Line and FST details


Line specific information

 
Line ID 499H06
Vector Used pAC161
Line Availability only available from NASC (N447898)
Segregation Analysis 50:25:17
Confirmed for Hit At5g20360
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g20360

 
Sequence (A. th genome BLAST matches underlined)
>48-K019700-022-499-H06-8409
ATCCTTGTTTAATCTTCTACACCTATAACCAGAAGTTCTTCCTCAATTATCACTTTTTCC
TGTTCCTTGCTCGTATCACTTCTCTTATCCGACTGTTTCCCTTTTACTTTCATTTTAATC
TTTTCCTTGCCTTTTTCAGCTAAAGACATTGTTCTTCTTCTCAGGCTCTACATCCTCACC
CTCAGCCTCGCTCTTCTCTTCCACTTGATTGCTCTTTTTAGTTTTCTTCACTCGAACCTT
GCCTATGGGATCCTCCCTTATAGCGAGAGATTGATAGGATGAATAAACTGAGAATTACTG
ATGATTCTTTTACAGCAAAGGTAAACGGAAGAGGTGGATGTAAAGTTGAAGATTGGATGA
TTGAATTTGCTCATCTTTTTAAGATCCAGGCCAGAATTGAATTCTGATAGATGCTTGAAT
CTTCAAGAACTTGGGATGAAACTTAATTCAGAAGCTATGGAGGAAGTGGTAACCTCCGAT
GCAGCTCAAGGTCCTTTTGACAGGGCAGCTCAGCAATTCCAAGAAGTTGCAGCTCGATCA
TTGTTAAACTTGGGATATGTGCACATGTCAGGGGCAAGGAAAAGGTTGAGCCTCCTACAA
GGTGTTTCTGGAGAATCTGTTTCTGAGCAAGTTAAAACTGCTTATGAATGCGCTAAGAAG
GAGCACGCAAATGCAAAAGAAAAGTATGAAGAGGCCATGAAAATAAAGCCAAAGTGTTTT
GAAGTCTTTCTGGCACTAGG
GenBank Accession BX533307 [GenBank]
Graphic View Graphic view of gene At5g20360
Predicted Position of Insertion Chr5:6883527 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F5O24
Hit Gene Code At5g20360 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Octicosapeptide/Phox/Bem1p (PB1) domain-containing protein / tetratricopeptide repeat (TPR)-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23