SimpleSearch - Line and FST details


Line specific information

 
Line ID 500E01
Vector Used pGABI1
Line Availability only available from NASC (N447953)
Segregation Analysis 50:18:11
Confirmed for Hit At4g17695
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g18490

 
Sequence (A. th genome BLAST matches underlined)
>05-K019227-022-500-E01-CR3S
TGTATTTGATTTGTAAATACTTCTATCATAAAATTTCTAATTCCTAAAACCAAAATCCAG
GTACTCATAAAGTTTCTAACCTGTGGGACGGATCCAGTGGTAGCTTTTCACTCAAATCTT
GTACCTTGGCAGTTTGGCTTGTACGAGTGCCTGGTGATATTTTGCCTGAGAGGGTTGTTA
GAGAATGTCCAGCATCTGAGTTATACAGTGCTCCTTTAGTGTTATCCTGTATTTCTGCCT
GAGTGTCTGTACCCATTTCTTCCTGTTGATGTTCTATCTTGTCTGAACATAAATGAGATG
AGATGCTTGGTGAAGTCTGTTCTATCTTCTCATAACTTGATTCCATGGTGGTAATCATTT
TCTTGTTGGCATTTTCTGGATCTATAGGACAGTCTTCTTTTGTACCAGACCTGCAGAGTT
CATGGATATCTGGACTGGTTTCTCTGTTTACTGCAATATGTGCAATCTCAGAAGCATGTA
ATGGCGAGGGTGCTATGGTCTCATTTGAAGGACATGGTTCATTCTTTTCTTCAACCTTTG
AACATGATGTCTTCAATGGTGAAGTATCTACGGATTGAGGTTGCACACACATTGTATGAG
TTTGTGAGGCTTTTTTTCTTGAACCCCTGAGTGATTCCACCGCCTCAAAATCTCCCATGC
TCTCTAATGCAGCTTGATTCGAGTTTTTGCTCTTATTAACAACAGAATATCTGTAGTCTT
GGTATTTTGGCTCTCTTTTTCAGCTGAAACTTTTGCCTGACATCTGTGTTTGCCTTGGAG
GGACTTGTCTA
GenBank Accession BX537032 [GenBank]
Graphic View Graphic view of gene At4g18490
Predicted Position of Insertion Chr4:10206187 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F28J12
Hit Gene Code At4g18490 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At4g17695

 
Sequence (A. th genome BLAST matches underlined)
>05-K019129-022-500-E01-8409
TGGGATCCTCCCTATAGTGAGCTCCTAAGATTCGCTAGATTACTTTGGGATCGGACTGCA
AATCTCTCTTCTTATGGAGCTTTTCCCTTCACAACCTGACTTGTACTTGAAGATCAGCCG
AAGAAGAGAAGAAGAACAAGAAAAAGAAAGTCTAGAACTACAAGAACAAGAAGTCGAAAG
GAGATTAGGGTTTCAGAGTAAAGCCTCAGATTTAGACAACAAGTCTTCAAATAATCTCAT
CCACACTCTCCAGTTCACTTCAAACAATGAAGCCACCAAGATTAATAGTAATCAAGAACA
CAAGGAATCTCTCGATCAAGACTTGAGATCTATTTTTATGATGAGACCAATAAGAGGAAT
CCCTCTTTACCAGAATCAAGTCCTTGACCACTACTACTACTCATCTACCTCTCCCAATCC
TTTCTTCTTCAGTGAAGTCAACGGTCAACATACTATGGGATCCTCCCTTATAGTGAGACT
ATGGGATCCTCCCTA
GenBank Accession BX533370 [GenBank]
Graphic View Graphic view of gene At4g17695
Predicted Position of Insertion Chr4:9850762 - go to primer design
BLAST e Value 4e-149
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g17695 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Homeodomain-like superfamily protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03