SimpleSearch - Line and FST details


Line specific information

 
Line ID 500E12
Vector Used pGABI1
Line Availability only available from NASC (N447964)
Segregation Analysis 50:24:20
Confirmed for Hit At5g27620
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g27620

 
Sequence (A. th genome BLAST matches underlined)
>93-K019329-022-500-E12-CR3S
CCGTGTATTTGCTACCTTTCGTCTCCCCAGACTCGATTCACTTGCAAAACTGTAACAACA
CGAGCAGCTCGGTCTTGCGACTTCAAGAATCTACATGTAGATCGTTGTGTTGATTATGTC
CACCAGAGACAACAACGACAAGGAATCGTTTCTTCTCTTTAGAAACACTATGGGATCCCG
CCTATAGTGAGAATGCTGGAGAACGTCTGTTAGAATAATTGTTGATATGGAGCTTTAGTC
CTGTATTCATGTTTAGATTTTAACTTATTGTTATTCATAGTGTGGAACAACTCAAGTTGA
AGTAGATGCTATGGGATCCTCCCCTATAGTGAGNAGTATGGGATCCTCCCTATAGCGAGA
CGGNNNAAAACGAACCAATAAAGGGAGACNACGGTTACGACCCACTTGGTTTCGATTTTG
GCTTCCGGGAATTTCAAACTTTTTGGAATCAAATGTTTTCAAAGAGAT
GenBank Accession BX537048 [GenBank]
Graphic View Graphic view of gene At5g27620
Predicted Position of Insertion Chr5:9771909 - go to primer design
BLAST e Value 1e-56
Hit Clone Code (BAC ID) F15A18
Hit Gene Code At5g27620 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cyclin H;1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX537047 [GenBank]

Gene hit At5g63390

 
Sequence (A. th genome BLAST matches underlined)
>93-K019567-022-500-E12-CR3S
GATCTGTACATACTTCGATCAATAAATATCTAATTCCTAAAACAACATCCAGGGGTATGG
GAGCCTCCCTATAGTGAGTCGTATTACTCATCGATTCACTTGCAAAACAGGAACAACAAG
AGCAGCTCGGTCTTGCAACTTCAAGAATCTACATGTAGATCGTTGTGTTGATTAAGTCCA
CCAGAGACAACAACAACAAGGAATCGTTTCTTCTCTTTAGAAACACTAGCTGATTTCTTC
TTGCATGGGATCCTCCCTATAGTGAGNCGTATTACTC
GenBank Accession BX537049 [GenBank]
Graphic View Graphic view of gene At5g63390
Predicted Position of Insertion Chr5:25391973 - go to primer design
BLAST e Value 2e-36
Hit Clone Code (BAC ID) K9H21
Hit Gene Code At5g63390 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation O-fucosyltransferase family protein
Insertion Classification CDSi
Confirmation Status unknown
Other FSTs Supporting this Hit BX537050 [GenBank]


Last Updated on 07.07.2016 14:03